Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631130_at:

>probe:Drosophila_2:1631130_at:661:289; Interrogation_Position=1238; Antisense; CGGACTCGTTTTGGTGCTTATCTAA
>probe:Drosophila_2:1631130_at:398:279; Interrogation_Position=1259; Antisense; CTAAGTTTCTCGACTGCATTCAGGA
>probe:Drosophila_2:1631130_at:436:155; Interrogation_Position=1344; Antisense; ACAGCGCATTGACGTGAACTTACAT
>probe:Drosophila_2:1631130_at:604:383; Interrogation_Position=1359; Antisense; GAACTTACATCGTCATCTACAGGCA
>probe:Drosophila_2:1631130_at:356:37; Interrogation_Position=1373; Antisense; ATCTACAGGCACATGGCGTCGACTA
>probe:Drosophila_2:1631130_at:705:149; Interrogation_Position=1397; Antisense; ACTTGCAATTCTCATTTCGCTGGAT
>probe:Drosophila_2:1631130_at:287:387; Interrogation_Position=1422; Antisense; GAACAATCTGCTGACACGCGAGCTG
>probe:Drosophila_2:1631130_at:687:613; Interrogation_Position=1451; Antisense; TGCACTGCACCATCCGATTGTGGGA
>probe:Drosophila_2:1631130_at:428:729; Interrogation_Position=1468; Antisense; TTGTGGGACACATATCTCGCAGAGT
>probe:Drosophila_2:1631130_at:452:181; Interrogation_Position=1565; Antisense; AACAAAACGATTTCCAGGGCCTCAT
>probe:Drosophila_2:1631130_at:442:83; Interrogation_Position=1580; Antisense; AGGGCCTCATGTTGCTGCTACAAAA
>probe:Drosophila_2:1631130_at:264:451; Interrogation_Position=1627; Antisense; GATCGACAAATCAACGTTCTGCTGG
>probe:Drosophila_2:1631130_at:458:71; Interrogation_Position=1655; Antisense; AGGCATTCCGCCTGAAGTTCACGTA
>probe:Drosophila_2:1631130_at:127:375; Interrogation_Position=1668; Antisense; GAAGTTCACGTATGCGGATGCGCCC

Paste this into a BLAST search page for me
CGGACTCGTTTTGGTGCTTATCTAACTAAGTTTCTCGACTGCATTCAGGAACAGCGCATTGACGTGAACTTACATGAACTTACATCGTCATCTACAGGCAATCTACAGGCACATGGCGTCGACTAACTTGCAATTCTCATTTCGCTGGATGAACAATCTGCTGACACGCGAGCTGTGCACTGCACCATCCGATTGTGGGATTGTGGGACACATATCTCGCAGAGTAACAAAACGATTTCCAGGGCCTCATAGGGCCTCATGTTGCTGCTACAAAAGATCGACAAATCAACGTTCTGCTGGAGGCATTCCGCCTGAAGTTCACGTAGAAGTTCACGTATGCGGATGCGCCC

Full Affymetrix probeset data:

Annotations for 1631130_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime