Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631133_at:

>probe:Drosophila_2:1631133_at:591:437; Interrogation_Position=1324; Antisense; GAGGCTAACACAGAAGTCGGGCTAC
>probe:Drosophila_2:1631133_at:446:665; Interrogation_Position=1346; Antisense; TACAAGAAGCACATGCTCACCCACA
>probe:Drosophila_2:1631133_at:501:379; Interrogation_Position=1378; Antisense; GAAGCCGCACGGCTGCGACATTTGC
>probe:Drosophila_2:1631133_at:678:717; Interrogation_Position=1412; Antisense; TTCCGCTACTCGAGCAATCTGATTG
>probe:Drosophila_2:1631133_at:330:111; Interrogation_Position=1424; Antisense; AGCAATCTGATTGCCCACAAGCGCT
>probe:Drosophila_2:1631133_at:582:205; Interrogation_Position=1442; Antisense; AAGCGCTGCCACAGCCAGGAGAAGC
>probe:Drosophila_2:1631133_at:598:107; Interrogation_Position=1488; Antisense; AGAAGCGCAGCTTCGGCAGCACATC
>probe:Drosophila_2:1631133_at:269:313; Interrogation_Position=1614; Antisense; GCCAGTCGCACAAGGCGGGCAGACA
>probe:Drosophila_2:1631133_at:684:317; Interrogation_Position=1649; Antisense; GCCGAGCATGAAGTGGGTGTCCAAC
>probe:Drosophila_2:1631133_at:711:595; Interrogation_Position=1693; Antisense; TGTGGAGACCTGAAGCTAGATCGCT
>probe:Drosophila_2:1631133_at:2:341; Interrogation_Position=1707; Antisense; GCTAGATCGCTTATACTATCGGCTT
>probe:Drosophila_2:1631133_at:404:41; Interrogation_Position=1724; Antisense; ATCGGCTTAATGTACAAATCGGGAC
>probe:Drosophila_2:1631133_at:357:601; Interrogation_Position=1762; Antisense; TCAATTCGCTTTTATTTTCGGTACT
>probe:Drosophila_2:1631133_at:337:539; Interrogation_Position=1781; Antisense; GGTACTTTCCTTCGCACAATAACAA

Paste this into a BLAST search page for me
GAGGCTAACACAGAAGTCGGGCTACTACAAGAAGCACATGCTCACCCACAGAAGCCGCACGGCTGCGACATTTGCTTCCGCTACTCGAGCAATCTGATTGAGCAATCTGATTGCCCACAAGCGCTAAGCGCTGCCACAGCCAGGAGAAGCAGAAGCGCAGCTTCGGCAGCACATCGCCAGTCGCACAAGGCGGGCAGACAGCCGAGCATGAAGTGGGTGTCCAACTGTGGAGACCTGAAGCTAGATCGCTGCTAGATCGCTTATACTATCGGCTTATCGGCTTAATGTACAAATCGGGACTCAATTCGCTTTTATTTTCGGTACTGGTACTTTCCTTCGCACAATAACAA

Full Affymetrix probeset data:

Annotations for 1631133_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime