FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631135_at:

>probe:Drosophila_2:1631135_at:72:79; Interrogation_Position=157; Antisense; AGGATCCACGACATTGGACTTCTCC
>probe:Drosophila_2:1631135_at:146:93; Interrogation_Position=207; Antisense; AGTTCACATTAAGCCCATTTGCCTG
>probe:Drosophila_2:1631135_at:563:163; Interrogation_Position=237; Antisense; AAATACGACCCTTCAGCCGAAGATT
>probe:Drosophila_2:1631135_at:441:393; Interrogation_Position=262; Antisense; GAAAGACTCCACAGGCTGGTAGCCA
>probe:Drosophila_2:1631135_at:264:407; Interrogation_Position=30; Antisense; GACTGTGCGACTGGGCGAGTTCAAC
>probe:Drosophila_2:1631135_at:29:379; Interrogation_Position=310; Antisense; GAAGCTGCAAACCACATCCTAAAGT
>probe:Drosophila_2:1631135_at:583:219; Interrogation_Position=331; Antisense; AAGTCCATTCGCGTAACCAGAGTGA
>probe:Drosophila_2:1631135_at:92:469; Interrogation_Position=385; Antisense; GTTGACCGTCGTAGGGATCAGATCT
>probe:Drosophila_2:1631135_at:428:139; Interrogation_Position=482; Antisense; ACGGTCGAGTGCTCTTCGTTCAGGT
>probe:Drosophila_2:1631135_at:449:79; Interrogation_Position=503; Antisense; AGGTCGGAATCGTTAGCTATGGCAA
>probe:Drosophila_2:1631135_at:56:281; Interrogation_Position=538; Antisense; CTCAGTCCCAGTGTTTTCACAAACG
>probe:Drosophila_2:1631135_at:624:453; Interrogation_Position=582; Antisense; GATAATGGCGGCGTTGAGCACAACT
>probe:Drosophila_2:1631135_at:513:191; Interrogation_Position=60; Antisense; AACTAGTATCGACTGCAACGGCTCC
>probe:Drosophila_2:1631135_at:477:283; Interrogation_Position=91; Antisense; CTGCCACCTTCCGAGGATTTTGAAA

Paste this into a BLAST search page for me
AGGATCCACGACATTGGACTTCTCCAGTTCACATTAAGCCCATTTGCCTGAAATACGACCCTTCAGCCGAAGATTGAAAGACTCCACAGGCTGGTAGCCAGACTGTGCGACTGGGCGAGTTCAACGAAGCTGCAAACCACATCCTAAAGTAAGTCCATTCGCGTAACCAGAGTGAGTTGACCGTCGTAGGGATCAGATCTACGGTCGAGTGCTCTTCGTTCAGGTAGGTCGGAATCGTTAGCTATGGCAACTCAGTCCCAGTGTTTTCACAAACGGATAATGGCGGCGTTGAGCACAACTAACTAGTATCGACTGCAACGGCTCCCTGCCACCTTCCGAGGATTTTGAAA

Full Affymetrix probeset data:

Annotations for 1631135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720