FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631137_at:

>probe:Drosophila_2:1631137_at:189:151; Interrogation_Position=1038; Antisense; ACATCCGCCGTTGAGAGCGAACGTT
>probe:Drosophila_2:1631137_at:160:657; Interrogation_Position=1077; Antisense; TAACCAGTCCTCAGGAATTTCCCTT
>probe:Drosophila_2:1631137_at:637:361; Interrogation_Position=1091; Antisense; GAATTTCCCTTGCACGTTTTCATTT
>probe:Drosophila_2:1631137_at:592:477; Interrogation_Position=1120; Antisense; GTTTTTTGGCATTTATGTACCCTCA
>probe:Drosophila_2:1631137_at:412:155; Interrogation_Position=597; Antisense; ACAGACCAAGTTCGTGCGCTCCGTT
>probe:Drosophila_2:1631137_at:592:613; Interrogation_Position=631; Antisense; TGCATACCAAACTTCCCCGAGAAGA
>probe:Drosophila_2:1631137_at:640:35; Interrogation_Position=667; Antisense; ATCTTTATCTACCACGAGGGTGCGC
>probe:Drosophila_2:1631137_at:547:621; Interrogation_Position=692; Antisense; TGCGCAAGCAGTACATAGGCCCACT
>probe:Drosophila_2:1631137_at:715:309; Interrogation_Position=805; Antisense; CCACGGCCGCAGATCAGGGACAAGA
>probe:Drosophila_2:1631137_at:332:559; Interrogation_Position=822; Antisense; GGACAAGATGCTTGCCGATCTCGAA
>probe:Drosophila_2:1631137_at:639:173; Interrogation_Position=851; Antisense; AAAGCTCGGACTTCTACTGAGTCAT
>probe:Drosophila_2:1631137_at:414:497; Interrogation_Position=871; Antisense; GTCATAGCCAAAGCATAGCCCTCAT
>probe:Drosophila_2:1631137_at:679:25; Interrogation_Position=885; Antisense; ATAGCCCTCATCCAACTTTAAGTTC
>probe:Drosophila_2:1631137_at:156:623; Interrogation_Position=958; Antisense; TCCAAAACCGGCAAGCGGATCTTTT

Paste this into a BLAST search page for me
ACATCCGCCGTTGAGAGCGAACGTTTAACCAGTCCTCAGGAATTTCCCTTGAATTTCCCTTGCACGTTTTCATTTGTTTTTTGGCATTTATGTACCCTCAACAGACCAAGTTCGTGCGCTCCGTTTGCATACCAAACTTCCCCGAGAAGAATCTTTATCTACCACGAGGGTGCGCTGCGCAAGCAGTACATAGGCCCACTCCACGGCCGCAGATCAGGGACAAGAGGACAAGATGCTTGCCGATCTCGAAAAAGCTCGGACTTCTACTGAGTCATGTCATAGCCAAAGCATAGCCCTCATATAGCCCTCATCCAACTTTAAGTTCTCCAAAACCGGCAAGCGGATCTTTT

Full Affymetrix probeset data:

Annotations for 1631137_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720