FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631138_at:

>probe:Drosophila_2:1631138_at:234:397; Interrogation_Position=1011; Antisense; GACACATTTGCTGGAGCTGCTAAAT
>probe:Drosophila_2:1631138_at:365:521; Interrogation_Position=1039; Antisense; GTGGCATTCGTTTTCACTTAACTAC
>probe:Drosophila_2:1631138_at:254:181; Interrogation_Position=1090; Antisense; AAAACTCGCAGTTGCCATCGGTCAG
>probe:Drosophila_2:1631138_at:149:79; Interrogation_Position=1143; Antisense; AGGATCTCCTCGATGTTGCGCTTGC
>probe:Drosophila_2:1631138_at:729:721; Interrogation_Position=1164; Antisense; TTGCCGTCCAGATCTGTGAACCAGT
>probe:Drosophila_2:1631138_at:148:381; Interrogation_Position=1181; Antisense; GAACCAGTTCAGATTGTCGGCGATC
>probe:Drosophila_2:1631138_at:586:71; Interrogation_Position=1231; Antisense; AGGTCACGATAACAACGCCGCGTTG
>probe:Drosophila_2:1631138_at:461:303; Interrogation_Position=1248; Antisense; CCGCGTTGGTATGCCAGCTTCGAAA
>probe:Drosophila_2:1631138_at:691:167; Interrogation_Position=1270; Antisense; AAATGGTCTTCATGTTCCGGGTCTG
>probe:Drosophila_2:1631138_at:421:515; Interrogation_Position=1308; Antisense; GTGTAGATCAGCTGCATCTTGGCCT
>probe:Drosophila_2:1631138_at:485:73; Interrogation_Position=1346; Antisense; AGGAATGCTATTCGTGGCCACCGTC
>probe:Drosophila_2:1631138_at:328:727; Interrogation_Position=1371; Antisense; TTGTCCGCATCGTCCTGGGAGCAGA
>probe:Drosophila_2:1631138_at:617:29; Interrogation_Position=921; Antisense; ATACATAACCTACCTGATGCTGGCC
>probe:Drosophila_2:1631138_at:517:545; Interrogation_Position=949; Antisense; GGATCCATATGTCGCCGGCAGTTCG

Paste this into a BLAST search page for me
GACACATTTGCTGGAGCTGCTAAATGTGGCATTCGTTTTCACTTAACTACAAAACTCGCAGTTGCCATCGGTCAGAGGATCTCCTCGATGTTGCGCTTGCTTGCCGTCCAGATCTGTGAACCAGTGAACCAGTTCAGATTGTCGGCGATCAGGTCACGATAACAACGCCGCGTTGCCGCGTTGGTATGCCAGCTTCGAAAAAATGGTCTTCATGTTCCGGGTCTGGTGTAGATCAGCTGCATCTTGGCCTAGGAATGCTATTCGTGGCCACCGTCTTGTCCGCATCGTCCTGGGAGCAGAATACATAACCTACCTGATGCTGGCCGGATCCATATGTCGCCGGCAGTTCG

Full Affymetrix probeset data:

Annotations for 1631138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720