Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631139_a_at:

>probe:Drosophila_2:1631139_a_at:178:551; Interrogation_Position=635; Antisense; GGAGATAGCACCCAGCCAGGATCAG
>probe:Drosophila_2:1631139_a_at:664:95; Interrogation_Position=637; Antisense; AGATAGCACCCAGCCAGGATCAGCA
>probe:Drosophila_2:1631139_a_at:464:545; Interrogation_Position=653; Antisense; GGATCAGCAGCAGCCGGCCGATTCG
>probe:Drosophila_2:1631139_a_at:505:297; Interrogation_Position=670; Antisense; CCGATTCGGACGTGGGCTATGTCTA
>probe:Drosophila_2:1631139_a_at:655:555; Interrogation_Position=677; Antisense; GGACGTGGGCTATGTCTACGATCTA
>probe:Drosophila_2:1631139_a_at:308:517; Interrogation_Position=681; Antisense; GTGGGCTATGTCTACGATCTATATG
>probe:Drosophila_2:1631139_a_at:197:681; Interrogation_Position=687; Antisense; TATGTCTACGATCTATATGTTCCCG
>probe:Drosophila_2:1631139_a_at:108:499; Interrogation_Position=690; Antisense; GTCTACGATCTATATGTTCCCGAGA
>probe:Drosophila_2:1631139_a_at:296:671; Interrogation_Position=693; Antisense; TACGATCTATATGTTCCCGAGAACG
>probe:Drosophila_2:1631139_a_at:166:59; Interrogation_Position=703; Antisense; ATGTTCCCGAGAACGAGATGCAGGC
>probe:Drosophila_2:1631139_a_at:627:295; Interrogation_Position=710; Antisense; CGAGAACGAGATGCAGGCGGCATAT
>probe:Drosophila_2:1631139_a_at:357:53; Interrogation_Position=720; Antisense; ATGCAGGCGGCATATGTGGACATGA
>probe:Drosophila_2:1631139_a_at:586:519; Interrogation_Position=735; Antisense; GTGGACATGATGGACGACAACTACT
>probe:Drosophila_2:1631139_a_at:320:153; Interrogation_Position=739; Antisense; ACATGATGGACGACAACTACTTAAG

Paste this into a BLAST search page for me
GGAGATAGCACCCAGCCAGGATCAGAGATAGCACCCAGCCAGGATCAGCAGGATCAGCAGCAGCCGGCCGATTCGCCGATTCGGACGTGGGCTATGTCTAGGACGTGGGCTATGTCTACGATCTAGTGGGCTATGTCTACGATCTATATGTATGTCTACGATCTATATGTTCCCGGTCTACGATCTATATGTTCCCGAGATACGATCTATATGTTCCCGAGAACGATGTTCCCGAGAACGAGATGCAGGCCGAGAACGAGATGCAGGCGGCATATATGCAGGCGGCATATGTGGACATGAGTGGACATGATGGACGACAACTACTACATGATGGACGACAACTACTTAAG

Full Affymetrix probeset data:

Annotations for 1631139_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime