FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631140_at:

>probe:Drosophila_2:1631140_at:145:349; Interrogation_Position=134; Antisense; GCATGGATTTCAGGGTGCGCAACGT
>probe:Drosophila_2:1631140_at:240:305; Interrogation_Position=167; Antisense; CCGGTCGGATGGTTATGCTGCAGAT
>probe:Drosophila_2:1631140_at:634:681; Interrogation_Position=180; Antisense; TATGCTGCAGATCTGGGATACCGCC
>probe:Drosophila_2:1631140_at:203:417; Interrogation_Position=211; Antisense; GAGCGCTTTAAGTCGCTGCTGCCAT
>probe:Drosophila_2:1631140_at:464:621; Interrogation_Position=227; Antisense; TGCTGCCATCCTATTATCGCGGTGC
>probe:Drosophila_2:1631140_at:157:453; Interrogation_Position=324; Antisense; GATACGGCGCATGTCTTCGGAAAGT
>probe:Drosophila_2:1631140_at:718:39; Interrogation_Position=383; Antisense; ATCTGGATAATCGTCAGGTGCGCAT
>probe:Drosophila_2:1631140_at:213:529; Interrogation_Position=414; Antisense; GGGTTTCAACTATGCCAATCATCGG
>probe:Drosophila_2:1631140_at:439:289; Interrogation_Position=436; Antisense; CGGGCACTCGGCTTTTATGAGGTTT
>probe:Drosophila_2:1631140_at:632:495; Interrogation_Position=504; Antisense; GTCAGTTGGCATATACAATCGTCTT
>probe:Drosophila_2:1631140_at:427:237; Interrogation_Position=520; Antisense; AATCGTCTTGTGATTCATACCCCAA
>probe:Drosophila_2:1631140_at:110:269; Interrogation_Position=535; Antisense; CATACCCCAAATCGCTTGTCAGGTG
>probe:Drosophila_2:1631140_at:48:391; Interrogation_Position=565; Antisense; GAAACGGAGGACACTGCAGAGCCAC
>probe:Drosophila_2:1631140_at:306:415; Interrogation_Position=583; Antisense; GAGCCACCGGATGAACCAATCAATT

Paste this into a BLAST search page for me
GCATGGATTTCAGGGTGCGCAACGTCCGGTCGGATGGTTATGCTGCAGATTATGCTGCAGATCTGGGATACCGCCGAGCGCTTTAAGTCGCTGCTGCCATTGCTGCCATCCTATTATCGCGGTGCGATACGGCGCATGTCTTCGGAAAGTATCTGGATAATCGTCAGGTGCGCATGGGTTTCAACTATGCCAATCATCGGCGGGCACTCGGCTTTTATGAGGTTTGTCAGTTGGCATATACAATCGTCTTAATCGTCTTGTGATTCATACCCCAACATACCCCAAATCGCTTGTCAGGTGGAAACGGAGGACACTGCAGAGCCACGAGCCACCGGATGAACCAATCAATT

Full Affymetrix probeset data:

Annotations for 1631140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720