FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631141_at:

>probe:Drosophila_2:1631141_at:571:111; Interrogation_Position=2205; Antisense; AGCACGGTCACGGTTTGGCAGCGAT
>probe:Drosophila_2:1631141_at:708:121; Interrogation_Position=2224; Antisense; AGCGATGGATCACGGCATGAGCCTT
>probe:Drosophila_2:1631141_at:352:57; Interrogation_Position=2240; Antisense; ATGAGCCTTGGCATGGAGCACGCAA
>probe:Drosophila_2:1631141_at:433:587; Interrogation_Position=2253; Antisense; TGGAGCACGCAATGGCGGCCTATGT
>probe:Drosophila_2:1631141_at:53:51; Interrogation_Position=2327; Antisense; ATGCCGTGGATGAGCGCACCGCAGC
>probe:Drosophila_2:1631141_at:374:185; Interrogation_Position=2365; Antisense; AACAGAACCGCTGAATCCACCTATA
>probe:Drosophila_2:1631141_at:291:47; Interrogation_Position=2569; Antisense; ATCCGCTTGAGCTTTTGGACTTCAT
>probe:Drosophila_2:1631141_at:621:557; Interrogation_Position=2585; Antisense; GGACTTCATAAGATCGATCCTGAGA
>probe:Drosophila_2:1631141_at:119:609; Interrogation_Position=2605; Antisense; TGAGAACACTCAGCTGCTCCAACGA
>probe:Drosophila_2:1631141_at:369:119; Interrogation_Position=2616; Antisense; AGCTGCTCCAACGATAGTGCTCGAC
>probe:Drosophila_2:1631141_at:570:679; Interrogation_Position=2630; Antisense; TAGTGCTCGACCCTGTGAGACTGTC
>probe:Drosophila_2:1631141_at:175:425; Interrogation_Position=2646; Antisense; GAGACTGTCCCTGCAATCAATTATG
>probe:Drosophila_2:1631141_at:318:693; Interrogation_Position=2678; Antisense; TTTTAATCCCGGACCACATATTCGC
>probe:Drosophila_2:1631141_at:138:311; Interrogation_Position=2691; Antisense; CCACATATTCGCTTTCACCATAAAA

Paste this into a BLAST search page for me
AGCACGGTCACGGTTTGGCAGCGATAGCGATGGATCACGGCATGAGCCTTATGAGCCTTGGCATGGAGCACGCAATGGAGCACGCAATGGCGGCCTATGTATGCCGTGGATGAGCGCACCGCAGCAACAGAACCGCTGAATCCACCTATAATCCGCTTGAGCTTTTGGACTTCATGGACTTCATAAGATCGATCCTGAGATGAGAACACTCAGCTGCTCCAACGAAGCTGCTCCAACGATAGTGCTCGACTAGTGCTCGACCCTGTGAGACTGTCGAGACTGTCCCTGCAATCAATTATGTTTTAATCCCGGACCACATATTCGCCCACATATTCGCTTTCACCATAAAA

Full Affymetrix probeset data:

Annotations for 1631141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720