Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631145_at:

>probe:Drosophila_2:1631145_at:158:339; Interrogation_Position=100; Antisense; GCTACCAGCGGATCCGGCTCTAGTT
>probe:Drosophila_2:1631145_at:328:281; Interrogation_Position=117; Antisense; CTCTAGTTCCGCCAGTGGAAGTGGA
>probe:Drosophila_2:1631145_at:11:615; Interrogation_Position=14; Antisense; TGAAGCTCGTCGCAATCACATTGGT
>probe:Drosophila_2:1631145_at:309:153; Interrogation_Position=160; Antisense; ACAGGAACTGGCACGGGAACTGGCA
>probe:Drosophila_2:1631145_at:344:129; Interrogation_Position=184; Antisense; ACGGGAACTGGCACTGGCACCTCGA
>probe:Drosophila_2:1631145_at:11:143; Interrogation_Position=196; Antisense; ACTGGCACCTCGACTACGTTGGCTC
>probe:Drosophila_2:1631145_at:82:263; Interrogation_Position=243; Antisense; CACCACCGTTGCTCCAGTGAAGAAA
>probe:Drosophila_2:1631145_at:30:725; Interrogation_Position=251; Antisense; TTGCTCCAGTGAAGAAAGTCCATCG
>probe:Drosophila_2:1631145_at:578:321; Interrogation_Position=282; Antisense; GCGCCACGTCATCCGGAAAATCGTA
>probe:Drosophila_2:1631145_at:125:151; Interrogation_Position=31; Antisense; ACATTGGTCGCATTTGTGGCCATTT
>probe:Drosophila_2:1631145_at:135:21; Interrogation_Position=42; Antisense; ATTTGTGGCCATTTGCCTGTATTCC
>probe:Drosophila_2:1631145_at:165:19; Interrogation_Position=52; Antisense; ATTTGCCTGTATTCCGTTGATTGCA
>probe:Drosophila_2:1631145_at:414:603; Interrogation_Position=69; Antisense; TGATTGCACCACATCCGGTACAGGA
>probe:Drosophila_2:1631145_at:489:537; Interrogation_Position=85; Antisense; GGTACAGGATCAGCTGCTACCAGCG

Paste this into a BLAST search page for me
GCTACCAGCGGATCCGGCTCTAGTTCTCTAGTTCCGCCAGTGGAAGTGGATGAAGCTCGTCGCAATCACATTGGTACAGGAACTGGCACGGGAACTGGCAACGGGAACTGGCACTGGCACCTCGAACTGGCACCTCGACTACGTTGGCTCCACCACCGTTGCTCCAGTGAAGAAATTGCTCCAGTGAAGAAAGTCCATCGGCGCCACGTCATCCGGAAAATCGTAACATTGGTCGCATTTGTGGCCATTTATTTGTGGCCATTTGCCTGTATTCCATTTGCCTGTATTCCGTTGATTGCATGATTGCACCACATCCGGTACAGGAGGTACAGGATCAGCTGCTACCAGCG

Full Affymetrix probeset data:

Annotations for 1631145_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime