FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631146_at:

>probe:Drosophila_2:1631146_at:225:449; Interrogation_Position=1515; Antisense; GATCGACCATGTGAAGGCAATGGAA
>probe:Drosophila_2:1631146_at:621:371; Interrogation_Position=1527; Antisense; GAAGGCAATGGAATCTCATATTTTA
>probe:Drosophila_2:1631146_at:297:239; Interrogation_Position=1538; Antisense; AATCTCATATTTTATTCCATTCTAG
>probe:Drosophila_2:1631146_at:298:17; Interrogation_Position=1546; Antisense; ATTTTATTCCATTCTAGAGCAGCGA
>probe:Drosophila_2:1631146_at:300:421; Interrogation_Position=1562; Antisense; GAGCAGCGAAATCAATTGCCCACAT
>probe:Drosophila_2:1631146_at:212:163; Interrogation_Position=1570; Antisense; AAATCAATTGCCCACATTCGCATGG
>probe:Drosophila_2:1631146_at:341:9; Interrogation_Position=1585; Antisense; ATTCGCATGGCCCAAAGTTTCTGGT
>probe:Drosophila_2:1631146_at:266:69; Interrogation_Position=1591; Antisense; ATGGCCCAAAGTTTCTGGTGAGAAA
>probe:Drosophila_2:1631146_at:352:229; Interrogation_Position=1622; Antisense; AATGGATGGCGCCACAGCTTTTTTC
>probe:Drosophila_2:1631146_at:519:67; Interrogation_Position=1627; Antisense; ATGGCGCCACAGCTTTTTTCTTAAA
>probe:Drosophila_2:1631146_at:268:323; Interrogation_Position=1630; Antisense; GCGCCACAGCTTTTTTCTTAAATCT
>probe:Drosophila_2:1631146_at:144:313; Interrogation_Position=1632; Antisense; GCCACAGCTTTTTTCTTAAATCTTT
>probe:Drosophila_2:1631146_at:144:663; Interrogation_Position=1676; Antisense; TAAAAGCAACAACTCGCTTCCTCTG
>probe:Drosophila_2:1631146_at:288:171; Interrogation_Position=1678; Antisense; AAAGCAACAACTCGCTTCCTCTGAA

Paste this into a BLAST search page for me
GATCGACCATGTGAAGGCAATGGAAGAAGGCAATGGAATCTCATATTTTAAATCTCATATTTTATTCCATTCTAGATTTTATTCCATTCTAGAGCAGCGAGAGCAGCGAAATCAATTGCCCACATAAATCAATTGCCCACATTCGCATGGATTCGCATGGCCCAAAGTTTCTGGTATGGCCCAAAGTTTCTGGTGAGAAAAATGGATGGCGCCACAGCTTTTTTCATGGCGCCACAGCTTTTTTCTTAAAGCGCCACAGCTTTTTTCTTAAATCTGCCACAGCTTTTTTCTTAAATCTTTTAAAAGCAACAACTCGCTTCCTCTGAAAGCAACAACTCGCTTCCTCTGAA

Full Affymetrix probeset data:

Annotations for 1631146_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720