FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631147_at:

>probe:Drosophila_2:1631147_at:168:557; Interrogation_Position=408; Antisense; GGACGACGAGACTTCGGAGAACATT
>probe:Drosophila_2:1631147_at:336:607; Interrogation_Position=443; Antisense; TGATGGCCTACTCGTTGTCTGAAAC
>probe:Drosophila_2:1631147_at:483:463; Interrogation_Position=469; Antisense; GATTCCGATTACTTTGATCCGAAAA
>probe:Drosophila_2:1631147_at:418:557; Interrogation_Position=507; Antisense; GGACTTTGACGTAGACACGGCCATG
>probe:Drosophila_2:1631147_at:247:527; Interrogation_Position=544; Antisense; GGGACATCCACTGAAACGGAATCCA
>probe:Drosophila_2:1631147_at:194:363; Interrogation_Position=562; Antisense; GAATCCACAATTGTTTCGGCGGCCA
>probe:Drosophila_2:1631147_at:713:519; Interrogation_Position=608; Antisense; GTGGCTTCCTTACCAGGCGAAGATT
>probe:Drosophila_2:1631147_at:656:581; Interrogation_Position=648; Antisense; TGGCACCAAGTCATCCACTTTGGAC
>probe:Drosophila_2:1631147_at:715:585; Interrogation_Position=668; Antisense; TGGACACCAAGGCATCCTTTGGCAA
>probe:Drosophila_2:1631147_at:325:359; Interrogation_Position=689; Antisense; GCAACGATGCGATCAGTGAGTCCTT
>probe:Drosophila_2:1631147_at:35:609; Interrogation_Position=705; Antisense; TGAGTCCTTGGAACGATTCATCGAG
>probe:Drosophila_2:1631147_at:629:201; Interrogation_Position=753; Antisense; AACCGCATATCGGATGCACACACGA
>probe:Drosophila_2:1631147_at:263:115; Interrogation_Position=814; Antisense; AGCTTGGAGAGCAATCTGGCCGCCA
>probe:Drosophila_2:1631147_at:355:149; Interrogation_Position=867; Antisense; ACTTCGTAATGATTCCACTCCGGAT

Paste this into a BLAST search page for me
GGACGACGAGACTTCGGAGAACATTTGATGGCCTACTCGTTGTCTGAAACGATTCCGATTACTTTGATCCGAAAAGGACTTTGACGTAGACACGGCCATGGGGACATCCACTGAAACGGAATCCAGAATCCACAATTGTTTCGGCGGCCAGTGGCTTCCTTACCAGGCGAAGATTTGGCACCAAGTCATCCACTTTGGACTGGACACCAAGGCATCCTTTGGCAAGCAACGATGCGATCAGTGAGTCCTTTGAGTCCTTGGAACGATTCATCGAGAACCGCATATCGGATGCACACACGAAGCTTGGAGAGCAATCTGGCCGCCAACTTCGTAATGATTCCACTCCGGAT

Full Affymetrix probeset data:

Annotations for 1631147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720