FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631148_at:

>probe:Drosophila_2:1631148_at:243:673; Interrogation_Position=309; Antisense; TACGCCGGCGGCAGCATTGTGAATG
>probe:Drosophila_2:1631148_at:232:513; Interrogation_Position=342; Antisense; GTGATCATCCATCCATCGTACGGAA
>probe:Drosophila_2:1631148_at:362:137; Interrogation_Position=376; Antisense; ACGACATCGCCATACTGGAGCTGGA
>probe:Drosophila_2:1631148_at:106:105; Interrogation_Position=403; Antisense; AGACCCTGGTCTTTAGCGATCGCAT
>probe:Drosophila_2:1631148_at:463:197; Interrogation_Position=492; Antisense; AACGGAACTCCGGTCTATGTGGCTG
>probe:Drosophila_2:1631148_at:247:531; Interrogation_Position=522; Antisense; GGTGAACTTTCGGATGGTACTGCAT
>probe:Drosophila_2:1631148_at:293:371; Interrogation_Position=560; Antisense; GAAGGCCAACTACAATACGCTGAGC
>probe:Drosophila_2:1631148_at:649:415; Interrogation_Position=581; Antisense; GAGCCGATCCCTGTGCGAATGGGAA
>probe:Drosophila_2:1631148_at:621:135; Interrogation_Position=697; Antisense; ACGACAAGGTGCTTCGCGGTTTGAC
>probe:Drosophila_2:1631148_at:132:539; Interrogation_Position=714; Antisense; GGTTTGACCAGCTTCAACTTCGGAC
>probe:Drosophila_2:1631148_at:412:111; Interrogation_Position=747; Antisense; AGCAAGTATCCGGATGTGGCCACCC
>probe:Drosophila_2:1631148_at:396:545; Interrogation_Position=793; Antisense; GGATCGAGGCCAATACCCAGTAAAA
>probe:Drosophila_2:1631148_at:652:693; Interrogation_Position=819; Antisense; TTTTGGTTCGCCATCCAAGGACTAC
>probe:Drosophila_2:1631148_at:401:663; Interrogation_Position=877; Antisense; TAAAGTGTGTTACTCCCTCTACAAA

Paste this into a BLAST search page for me
TACGCCGGCGGCAGCATTGTGAATGGTGATCATCCATCCATCGTACGGAAACGACATCGCCATACTGGAGCTGGAAGACCCTGGTCTTTAGCGATCGCATAACGGAACTCCGGTCTATGTGGCTGGGTGAACTTTCGGATGGTACTGCATGAAGGCCAACTACAATACGCTGAGCGAGCCGATCCCTGTGCGAATGGGAAACGACAAGGTGCTTCGCGGTTTGACGGTTTGACCAGCTTCAACTTCGGACAGCAAGTATCCGGATGTGGCCACCCGGATCGAGGCCAATACCCAGTAAAATTTTGGTTCGCCATCCAAGGACTACTAAAGTGTGTTACTCCCTCTACAAA

Full Affymetrix probeset data:

Annotations for 1631148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720