Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631150_at:

>probe:Drosophila_2:1631150_at:519:233; Interrogation_Position=1012; Antisense; AATGCTGACATTCGCTATCGTCGGG
>probe:Drosophila_2:1631150_at:381:639; Interrogation_Position=1029; Antisense; TCGTCGGGCTCTGGTATTCTTTATA
>probe:Drosophila_2:1631150_at:432:159; Interrogation_Position=1142; Antisense; ACAAATTTTTCGCTCTGCTTCGTAC
>probe:Drosophila_2:1631150_at:462:401; Interrogation_Position=587; Antisense; GACATACTTCGGCATCGGGACAGAT
>probe:Drosophila_2:1631150_at:409:37; Interrogation_Position=610; Antisense; ATCTCTACGGATCTTTTGCTTTGTG
>probe:Drosophila_2:1631150_at:119:233; Interrogation_Position=654; Antisense; AATGCACTTCGATTACTTGGCCAGA
>probe:Drosophila_2:1631150_at:617:161; Interrogation_Position=744; Antisense; ACAATATCATCAGCGCATTCTTCGG
>probe:Drosophila_2:1631150_at:682:11; Interrogation_Position=760; Antisense; ATTCTTCGGCTAATGGACGTTCTCA
>probe:Drosophila_2:1631150_at:716:443; Interrogation_Position=798; Antisense; GATACCGCTACTGCTTAACTTTATG
>probe:Drosophila_2:1631150_at:171:705; Interrogation_Position=818; Antisense; TTATGGTCTCCACATTTGTCATCTG
>probe:Drosophila_2:1631150_at:659:599; Interrogation_Position=834; Antisense; TGTCATCTGCTTTGTGGGATTCCAA
>probe:Drosophila_2:1631150_at:419:461; Interrogation_Position=888; Antisense; GATTAAGCTCTTCTTGTTCCTGTTC
>probe:Drosophila_2:1631150_at:51:515; Interrogation_Position=928; Antisense; GTGTACTTGATATGCCACTACGGCC
>probe:Drosophila_2:1631150_at:677:417; Interrogation_Position=969; Antisense; GAGCTCTAGCTTATCGATTTCTGCA

Paste this into a BLAST search page for me
AATGCTGACATTCGCTATCGTCGGGTCGTCGGGCTCTGGTATTCTTTATAACAAATTTTTCGCTCTGCTTCGTACGACATACTTCGGCATCGGGACAGATATCTCTACGGATCTTTTGCTTTGTGAATGCACTTCGATTACTTGGCCAGAACAATATCATCAGCGCATTCTTCGGATTCTTCGGCTAATGGACGTTCTCAGATACCGCTACTGCTTAACTTTATGTTATGGTCTCCACATTTGTCATCTGTGTCATCTGCTTTGTGGGATTCCAAGATTAAGCTCTTCTTGTTCCTGTTCGTGTACTTGATATGCCACTACGGCCGAGCTCTAGCTTATCGATTTCTGCA

Full Affymetrix probeset data:

Annotations for 1631150_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime