FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631151_at:

>probe:Drosophila_2:1631151_at:217:301; Interrogation_Position=1006; Antisense; CCCAAGCCGCGCGAGGTTAAGATTT
>probe:Drosophila_2:1631151_at:184:385; Interrogation_Position=1062; Antisense; GAACACGAATGTGCCTTCAACTTGC
>probe:Drosophila_2:1631151_at:155:361; Interrogation_Position=530; Antisense; GCAAGATCCGCGTAGCAAACTCAGG
>probe:Drosophila_2:1631151_at:611:235; Interrogation_Position=578; Antisense; AATCGAAGCCCAAGCACATTGACGC
>probe:Drosophila_2:1631151_at:554:5; Interrogation_Position=595; Antisense; ATTGACGCCGACAACGAGGATGACA
>probe:Drosophila_2:1631151_at:446:347; Interrogation_Position=665; Antisense; GCAGGTCCATTTCCCAAGGAGGCGA
>probe:Drosophila_2:1631151_at:92:171; Interrogation_Position=690; Antisense; AAAGGATAAGGCTTCTTCCAGCAGC
>probe:Drosophila_2:1631151_at:143:151; Interrogation_Position=755; Antisense; ACAGTCCATCACAGCAGAATTCCAG
>probe:Drosophila_2:1631151_at:489:111; Interrogation_Position=770; Antisense; AGAATTCCAGATCCAGCTCCGTTGA
>probe:Drosophila_2:1631151_at:578:349; Interrogation_Position=884; Antisense; GCAGAGGACCCAAGCCCAAAGTGAA
>probe:Drosophila_2:1631151_at:388:613; Interrogation_Position=905; Antisense; TGAAACGAGTATCGCCAGTGCCGGC
>probe:Drosophila_2:1631151_at:415:267; Interrogation_Position=920; Antisense; CAGTGCCGGCCAAAGATTTCAAGGT
>probe:Drosophila_2:1631151_at:33:141; Interrogation_Position=956; Antisense; ACGGAGGGCGGTTCAATGCATTGCA
>probe:Drosophila_2:1631151_at:359:559; Interrogation_Position=987; Antisense; GGACAGCATGCTGGACACGCCCAAG

Paste this into a BLAST search page for me
CCCAAGCCGCGCGAGGTTAAGATTTGAACACGAATGTGCCTTCAACTTGCGCAAGATCCGCGTAGCAAACTCAGGAATCGAAGCCCAAGCACATTGACGCATTGACGCCGACAACGAGGATGACAGCAGGTCCATTTCCCAAGGAGGCGAAAAGGATAAGGCTTCTTCCAGCAGCACAGTCCATCACAGCAGAATTCCAGAGAATTCCAGATCCAGCTCCGTTGAGCAGAGGACCCAAGCCCAAAGTGAATGAAACGAGTATCGCCAGTGCCGGCCAGTGCCGGCCAAAGATTTCAAGGTACGGAGGGCGGTTCAATGCATTGCAGGACAGCATGCTGGACACGCCCAAG

Full Affymetrix probeset data:

Annotations for 1631151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720