Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631152_at:

>probe:Drosophila_2:1631152_at:704:119; Interrogation_Position=1246; Antisense; AGCTGATGGACTATGCCGACGTGGC
>probe:Drosophila_2:1631152_at:283:253; Interrogation_Position=1270; Antisense; CAACCACAGTTTTTACTCCGCTAGA
>probe:Drosophila_2:1631152_at:83:241; Interrogation_Position=1294; Antisense; AATACAGTTGCGTCGGCATGTCGGA
>probe:Drosophila_2:1631152_at:563:193; Interrogation_Position=1333; Antisense; AACTGCGTGGTGCTGACAACATCGA
>probe:Drosophila_2:1631152_at:180:159; Interrogation_Position=1348; Antisense; ACAACATCGAGGTCTTCCACGGCTA
>probe:Drosophila_2:1631152_at:555:671; Interrogation_Position=1422; Antisense; TACCTCAAGGCCGTAGCCGAAGTGT
>probe:Drosophila_2:1631152_at:496:569; Interrogation_Position=1533; Antisense; GGCTTGACCGTAAAGACGCTTCTGA
>probe:Drosophila_2:1631152_at:134:105; Interrogation_Position=1546; Antisense; AGACGCTTCTGAACACGGTGGGAAT
>probe:Drosophila_2:1631152_at:445:573; Interrogation_Position=1600; Antisense; GGCTGTCAATCACCAAGCGATCTGG
>probe:Drosophila_2:1631152_at:292:253; Interrogation_Position=1613; Antisense; CAAGCGATCTGGTCGGGATCCTACA
>probe:Drosophila_2:1631152_at:426:127; Interrogation_Position=1637; Antisense; ACCAGCCTCCTGTTGCAGTTAGTTC
>probe:Drosophila_2:1631152_at:144:265; Interrogation_Position=1652; Antisense; CAGTTAGTTCCGTGCCTTGGAGATA
>probe:Drosophila_2:1631152_at:100:479; Interrogation_Position=1724; Antisense; GTTTCAGTCCGTATCTACTGTCGAT
>probe:Drosophila_2:1631152_at:429:71; Interrogation_Position=1762; Antisense; AGGCTACACACCATTTTCATTCTAA

Paste this into a BLAST search page for me
AGCTGATGGACTATGCCGACGTGGCCAACCACAGTTTTTACTCCGCTAGAAATACAGTTGCGTCGGCATGTCGGAAACTGCGTGGTGCTGACAACATCGAACAACATCGAGGTCTTCCACGGCTATACCTCAAGGCCGTAGCCGAAGTGTGGCTTGACCGTAAAGACGCTTCTGAAGACGCTTCTGAACACGGTGGGAATGGCTGTCAATCACCAAGCGATCTGGCAAGCGATCTGGTCGGGATCCTACAACCAGCCTCCTGTTGCAGTTAGTTCCAGTTAGTTCCGTGCCTTGGAGATAGTTTCAGTCCGTATCTACTGTCGATAGGCTACACACCATTTTCATTCTAA

Full Affymetrix probeset data:

Annotations for 1631152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime