Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631153_at:

>probe:Drosophila_2:1631153_at:701:325; Interrogation_Position=1961; Antisense; GCGATTTTCGTCTTTCTGTTTCCGT
>probe:Drosophila_2:1631153_at:180:705; Interrogation_Position=1998; Antisense; TTATAAAATGCTTACACTCTGCTGC
>probe:Drosophila_2:1631153_at:372:167; Interrogation_Position=2003; Antisense; AAATGCTTACACTCTGCTGCAGACA
>probe:Drosophila_2:1631153_at:62:641; Interrogation_Position=2015; Antisense; TCTGCTGCAGACACGCCAACCGGAA
>probe:Drosophila_2:1631153_at:220:133; Interrogation_Position=2027; Antisense; ACGCCAACCGGAAGTGCGCACTAAG
>probe:Drosophila_2:1631153_at:70:325; Interrogation_Position=2042; Antisense; GCGCACTAAGCGCTTGTTTGTAGCA
>probe:Drosophila_2:1631153_at:626:121; Interrogation_Position=2050; Antisense; AGCGCTTGTTTGTAGCACAGTGTAG
>probe:Drosophila_2:1631153_at:724:257; Interrogation_Position=2065; Antisense; CACAGTGTAGAATTCTGGCGTAATT
>probe:Drosophila_2:1631153_at:393:581; Interrogation_Position=2080; Antisense; TGGCGTAATTTACAGCTCTACTTTA
>probe:Drosophila_2:1631153_at:482:155; Interrogation_Position=2091; Antisense; ACAGCTCTACTTTAAAGTCTTCTAG
>probe:Drosophila_2:1631153_at:63:217; Interrogation_Position=2105; Antisense; AAGTCTTCTAGATAGCTATCTACTA
>probe:Drosophila_2:1631153_at:221:179; Interrogation_Position=2135; Antisense; AAACTTATTTATTGTCTTGAATGTA
>probe:Drosophila_2:1631153_at:627:599; Interrogation_Position=2171; Antisense; TGTATTGATGGTGATCACGTTTTTT
>probe:Drosophila_2:1631153_at:665:699; Interrogation_Position=2192; Antisense; TTTTTTGTCCTATAACAAGCTGCAA

Paste this into a BLAST search page for me
GCGATTTTCGTCTTTCTGTTTCCGTTTATAAAATGCTTACACTCTGCTGCAAATGCTTACACTCTGCTGCAGACATCTGCTGCAGACACGCCAACCGGAAACGCCAACCGGAAGTGCGCACTAAGGCGCACTAAGCGCTTGTTTGTAGCAAGCGCTTGTTTGTAGCACAGTGTAGCACAGTGTAGAATTCTGGCGTAATTTGGCGTAATTTACAGCTCTACTTTAACAGCTCTACTTTAAAGTCTTCTAGAAGTCTTCTAGATAGCTATCTACTAAAACTTATTTATTGTCTTGAATGTATGTATTGATGGTGATCACGTTTTTTTTTTTTGTCCTATAACAAGCTGCAA

Full Affymetrix probeset data:

Annotations for 1631153_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime