FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631154_at:

>probe:Drosophila_2:1631154_at:597:303; Interrogation_Position=1009; Antisense; CCGTCGTCTGCCTACTAATTTATAA
>probe:Drosophila_2:1631154_at:145:127; Interrogation_Position=478; Antisense; ACCAGTGTTTGTACATCCCCTACGG
>probe:Drosophila_2:1631154_at:145:553; Interrogation_Position=509; Antisense; GGAGCACCGTCTGGAAGCCTATGAA
>probe:Drosophila_2:1631154_at:705:203; Interrogation_Position=523; Antisense; AAGCCTATGAAGTGCTGGTCCAGCC
>probe:Drosophila_2:1631154_at:727:423; Interrogation_Position=549; Antisense; GAGACGTGGATAGCCTCTAGCGGAC
>probe:Drosophila_2:1631154_at:616:549; Interrogation_Position=570; Antisense; GGACGCGGCATTGTTCCCGGAACAG
>probe:Drosophila_2:1631154_at:342:411; Interrogation_Position=609; Antisense; GACGCCGATGGCGATCAGATCTATG
>probe:Drosophila_2:1631154_at:604:35; Interrogation_Position=622; Antisense; ATCAGATCTATGTGGGTCGCGCCTA
>probe:Drosophila_2:1631154_at:411:137; Interrogation_Position=649; Antisense; ACGAGGGCGATTTGCTGCCAGCCAA
>probe:Drosophila_2:1631154_at:500:79; Interrogation_Position=673; Antisense; AGGTGATCCCCAACAAGGGCTGTGC
>probe:Drosophila_2:1631154_at:292:137; Interrogation_Position=733; Antisense; ACGACTACGAGCTGCTGGCCGGATA
>probe:Drosophila_2:1631154_at:90:65; Interrogation_Position=767; Antisense; ATGGGTGCACGACAGCCATGGCAAT
>probe:Drosophila_2:1631154_at:643:221; Interrogation_Position=966; Antisense; AAGGGCTGAGCTGCTACAGCGACTA
>probe:Drosophila_2:1631154_at:350:325; Interrogation_Position=984; Antisense; GCGACTAGACTTTTGTGTTGTCCCC

Paste this into a BLAST search page for me
CCGTCGTCTGCCTACTAATTTATAAACCAGTGTTTGTACATCCCCTACGGGGAGCACCGTCTGGAAGCCTATGAAAAGCCTATGAAGTGCTGGTCCAGCCGAGACGTGGATAGCCTCTAGCGGACGGACGCGGCATTGTTCCCGGAACAGGACGCCGATGGCGATCAGATCTATGATCAGATCTATGTGGGTCGCGCCTAACGAGGGCGATTTGCTGCCAGCCAAAGGTGATCCCCAACAAGGGCTGTGCACGACTACGAGCTGCTGGCCGGATAATGGGTGCACGACAGCCATGGCAATAAGGGCTGAGCTGCTACAGCGACTAGCGACTAGACTTTTGTGTTGTCCCC

Full Affymetrix probeset data:

Annotations for 1631154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720