FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631155_at:

>probe:Drosophila_2:1631155_at:35:213; Interrogation_Position=1001; Antisense; AAGACTATCACACTTTGCGATTAGA
>probe:Drosophila_2:1631155_at:480:109; Interrogation_Position=1032; Antisense; AGAAGACACAATTGCGACTCGAACA
>probe:Drosophila_2:1631155_at:301:53; Interrogation_Position=1160; Antisense; ATGCTATGACATCCTTACCACACGA
>probe:Drosophila_2:1631155_at:220:419; Interrogation_Position=1195; Antisense; GAGCTGATAGCCGAAGATTATGTAT
>probe:Drosophila_2:1631155_at:159:263; Interrogation_Position=622; Antisense; CAGCTGTTTGACTCACTTTGGCGTG
>probe:Drosophila_2:1631155_at:290:501; Interrogation_Position=659; Antisense; GTCGTGTGCTGATGCTTGTTGGTAC
>probe:Drosophila_2:1631155_at:315:725; Interrogation_Position=674; Antisense; TTGTTGGTACGCAAGCTCAAGAGCT
>probe:Drosophila_2:1631155_at:450:213; Interrogation_Position=692; Antisense; AAGAGCTAGCCGACGAATACGATAA
>probe:Drosophila_2:1631155_at:417:393; Interrogation_Position=760; Antisense; GAAAGATTTACTGAGCGCGATGAAG
>probe:Drosophila_2:1631155_at:290:713; Interrogation_Position=818; Antisense; TTCATCGAAAAATTGCGGAGCTTAT
>probe:Drosophila_2:1631155_at:468:47; Interrogation_Position=916; Antisense; ATGACCGAAATAGATGACGTTCCTA
>probe:Drosophila_2:1631155_at:649:403; Interrogation_Position=931; Antisense; GACGTTCCTATTGAACTCCGAGTAT
>probe:Drosophila_2:1631155_at:281:485; Interrogation_Position=952; Antisense; GTATGTGTTGATGACCGTGACGCCA
>probe:Drosophila_2:1631155_at:100:609; Interrogation_Position=963; Antisense; TGACCGTGACGCCATTTTAAATTTA

Paste this into a BLAST search page for me
AAGACTATCACACTTTGCGATTAGAAGAAGACACAATTGCGACTCGAACAATGCTATGACATCCTTACCACACGAGAGCTGATAGCCGAAGATTATGTATCAGCTGTTTGACTCACTTTGGCGTGGTCGTGTGCTGATGCTTGTTGGTACTTGTTGGTACGCAAGCTCAAGAGCTAAGAGCTAGCCGACGAATACGATAAGAAAGATTTACTGAGCGCGATGAAGTTCATCGAAAAATTGCGGAGCTTATATGACCGAAATAGATGACGTTCCTAGACGTTCCTATTGAACTCCGAGTATGTATGTGTTGATGACCGTGACGCCATGACCGTGACGCCATTTTAAATTTA

Full Affymetrix probeset data:

Annotations for 1631155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720