FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631157_at:

>probe:Drosophila_2:1631157_at:62:625; Interrogation_Position=1093; Antisense; TGCGCTTCGAGTGTCCATGTCTGAT
>probe:Drosophila_2:1631157_at:195:437; Interrogation_Position=1200; Antisense; GAGGAGTTCAACACCGAGACATTTA
>probe:Drosophila_2:1631157_at:16:457; Interrogation_Position=1226; Antisense; GATAAATGTACAGCCCTTCTCGCAG
>probe:Drosophila_2:1631157_at:12:525; Interrogation_Position=1278; Antisense; GGGCAGACGGATACCCGATTCTTCT
>probe:Drosophila_2:1631157_at:371:461; Interrogation_Position=1294; Antisense; GATTCTTCTCGGAGGACTGCTTCCA
>probe:Drosophila_2:1631157_at:707:573; Interrogation_Position=1343; Antisense; GGCGGCCAACTCCATATGGAACAAT
>probe:Drosophila_2:1631157_at:596:31; Interrogation_Position=1387; Antisense; ATAAGAGCGGATTCGCTACCCATCT
>probe:Drosophila_2:1631157_at:93:597; Interrogation_Position=1453; Antisense; TGATCACCCGGGAGAACAGTCGACC
>probe:Drosophila_2:1631157_at:480:411; Interrogation_Position=1474; Antisense; GACCGGAGTTCGTGATCTCATCCAA
>probe:Drosophila_2:1631157_at:602:631; Interrogation_Position=1521; Antisense; TCCGTGAATTACTCCCTGTGATATC
>probe:Drosophila_2:1631157_at:723:513; Interrogation_Position=1538; Antisense; GTGATATCGCACCTAAGTCTTCTTC
>probe:Drosophila_2:1631157_at:166:219; Interrogation_Position=1552; Antisense; AAGTCTTCTTCGCTAGCTTGCCAGT
>probe:Drosophila_2:1631157_at:367:343; Interrogation_Position=1567; Antisense; GCTTGCCAGTGTATTTGTAGTCCTA
>probe:Drosophila_2:1631157_at:264:483; Interrogation_Position=1583; Antisense; GTAGTCCTAATTAGCCGTATGCCAA

Paste this into a BLAST search page for me
TGCGCTTCGAGTGTCCATGTCTGATGAGGAGTTCAACACCGAGACATTTAGATAAATGTACAGCCCTTCTCGCAGGGGCAGACGGATACCCGATTCTTCTGATTCTTCTCGGAGGACTGCTTCCAGGCGGCCAACTCCATATGGAACAATATAAGAGCGGATTCGCTACCCATCTTGATCACCCGGGAGAACAGTCGACCGACCGGAGTTCGTGATCTCATCCAATCCGTGAATTACTCCCTGTGATATCGTGATATCGCACCTAAGTCTTCTTCAAGTCTTCTTCGCTAGCTTGCCAGTGCTTGCCAGTGTATTTGTAGTCCTAGTAGTCCTAATTAGCCGTATGCCAA

Full Affymetrix probeset data:

Annotations for 1631157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720