FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631158_at:

>probe:Drosophila_2:1631158_at:276:383; Interrogation_Position=108; Antisense; GAACTCGATCACTATCTGCGATGTT
>probe:Drosophila_2:1631158_at:300:219; Interrogation_Position=136; Antisense; AAGTGGTGACTGATGCCGGTGCCCT
>probe:Drosophila_2:1631158_at:334:627; Interrogation_Position=149; Antisense; TGCCGGTGCCCTAATGATCGAGAAC
>probe:Drosophila_2:1631158_at:339:449; Interrogation_Position=164; Antisense; GATCGAGAACTCTATAACGGCCATA
>probe:Drosophila_2:1631158_at:434:31; Interrogation_Position=186; Antisense; ATAAGCCTCCTATCCGATTGCGTTG
>probe:Drosophila_2:1631158_at:614:463; Interrogation_Position=201; Antisense; GATTGCGTTGATTTTCAGCCGAAAA
>probe:Drosophila_2:1631158_at:705:641; Interrogation_Position=245; Antisense; TCTCAGATTTATTAGGGTGGCCCAT
>probe:Drosophila_2:1631158_at:540:411; Interrogation_Position=298; Antisense; GACCGGAATGTCTCGTACAAACCTT
>probe:Drosophila_2:1631158_at:195:699; Interrogation_Position=321; Antisense; TTTACCACCGGAGTCGGACTGATTA
>probe:Drosophila_2:1631158_at:68:557; Interrogation_Position=336; Antisense; GGACTGATTAGACCGATTATAGCCA
>probe:Drosophila_2:1631158_at:64:419; Interrogation_Position=387; Antisense; GAGTAAGACAACCTACCTAGTTTGA
>probe:Drosophila_2:1631158_at:587:449; Interrogation_Position=41; Antisense; GATCGCCTTGTTACTAAGCTTTTTG
>probe:Drosophila_2:1631158_at:603:25; Interrogation_Position=427; Antisense; ATACCGAAAGTTTGCCTGGCCAAGC
>probe:Drosophila_2:1631158_at:259:205; Interrogation_Position=91; Antisense; AAGCCGCCATAAGTTCGGAACTCGA

Paste this into a BLAST search page for me
GAACTCGATCACTATCTGCGATGTTAAGTGGTGACTGATGCCGGTGCCCTTGCCGGTGCCCTAATGATCGAGAACGATCGAGAACTCTATAACGGCCATAATAAGCCTCCTATCCGATTGCGTTGGATTGCGTTGATTTTCAGCCGAAAATCTCAGATTTATTAGGGTGGCCCATGACCGGAATGTCTCGTACAAACCTTTTTACCACCGGAGTCGGACTGATTAGGACTGATTAGACCGATTATAGCCAGAGTAAGACAACCTACCTAGTTTGAGATCGCCTTGTTACTAAGCTTTTTGATACCGAAAGTTTGCCTGGCCAAGCAAGCCGCCATAAGTTCGGAACTCGA

Full Affymetrix probeset data:

Annotations for 1631158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720