Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631161_at:

>probe:Drosophila_2:1631161_at:575:363; Interrogation_Position=1470; Antisense; GAATAGCTTCATGGAATCTTGGCAT
>probe:Drosophila_2:1631161_at:244:273; Interrogation_Position=1515; Antisense; CTTAGGAACTTAACTAGCGAGCGAT
>probe:Drosophila_2:1631161_at:347:563; Interrogation_Position=1557; Antisense; GGAACCACGACAGACTTGGACGTCA
>probe:Drosophila_2:1631161_at:208:557; Interrogation_Position=1574; Antisense; GGACGTCAGGGCATATACAATATAC
>probe:Drosophila_2:1631161_at:668:29; Interrogation_Position=1624; Antisense; ATACACACTGCTTAAGTTCACCCGT
>probe:Drosophila_2:1631161_at:255:521; Interrogation_Position=1647; Antisense; GTGGCTGGGCCTACAAATTCAACAT
>probe:Drosophila_2:1631161_at:328:7; Interrogation_Position=1724; Antisense; ATTGCTTCATATGAGTTGCGTTAAC
>probe:Drosophila_2:1631161_at:133:327; Interrogation_Position=1741; Antisense; GCGTTAACTATATTCGGCAAACTAA
>probe:Drosophila_2:1631161_at:141:359; Interrogation_Position=1757; Antisense; GCAAACTAAATTCCTTTCCGGCGCA
>probe:Drosophila_2:1631161_at:252:695; Interrogation_Position=1771; Antisense; TTTCCGGCGCACTTAAATTCATTGT
>probe:Drosophila_2:1631161_at:101:679; Interrogation_Position=1856; Antisense; TAGTTATTTATCCAGTTTCGTTGTT
>probe:Drosophila_2:1631161_at:545:175; Interrogation_Position=1882; Antisense; AAACCCGGATTTTATGCATCTTCAG
>probe:Drosophila_2:1631161_at:370:347; Interrogation_Position=1897; Antisense; GCATCTTCAGAACGCTCTTAATGTT
>probe:Drosophila_2:1631161_at:169:475; Interrogation_Position=1976; Antisense; GTTAAACCCTACTAGTTGATACAGA

Paste this into a BLAST search page for me
GAATAGCTTCATGGAATCTTGGCATCTTAGGAACTTAACTAGCGAGCGATGGAACCACGACAGACTTGGACGTCAGGACGTCAGGGCATATACAATATACATACACACTGCTTAAGTTCACCCGTGTGGCTGGGCCTACAAATTCAACATATTGCTTCATATGAGTTGCGTTAACGCGTTAACTATATTCGGCAAACTAAGCAAACTAAATTCCTTTCCGGCGCATTTCCGGCGCACTTAAATTCATTGTTAGTTATTTATCCAGTTTCGTTGTTAAACCCGGATTTTATGCATCTTCAGGCATCTTCAGAACGCTCTTAATGTTGTTAAACCCTACTAGTTGATACAGA

Full Affymetrix probeset data:

Annotations for 1631161_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime