FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631163_at:

>probe:Drosophila_2:1631163_at:27:685; Interrogation_Position=1013; Antisense; TTAAAACTCTCCATCGTTGGACCCA
>probe:Drosophila_2:1631163_at:692:45; Interrogation_Position=1037; Antisense; AGACGAAGACGGTGGCTACCTCAAC
>probe:Drosophila_2:1631163_at:672:571; Interrogation_Position=1050; Antisense; GGCTACCTCAACCTACAAACGAATG
>probe:Drosophila_2:1631163_at:700:165; Interrogation_Position=1131; Antisense; AAATCGGATAACTCAGCCACCATAT
>probe:Drosophila_2:1631163_at:119:181; Interrogation_Position=1163; Antisense; AAAATTCGCTACTGGGTGTTCTTAT
>probe:Drosophila_2:1631163_at:252:531; Interrogation_Position=1176; Antisense; GGGTGTTCTTATACCAAATCCAGAC
>probe:Drosophila_2:1631163_at:628:249; Interrogation_Position=1210; Antisense; CTAGGATTTATTCCCAAGGCTCCAC
>probe:Drosophila_2:1631163_at:500:505; Interrogation_Position=1238; Antisense; GTGCCCTGTCAATGCTTCGTAAAAG
>probe:Drosophila_2:1631163_at:730:629; Interrogation_Position=735; Antisense; TCCTGTGAGGCCTAACGATGTCGAT
>probe:Drosophila_2:1631163_at:613:625; Interrogation_Position=827; Antisense; TGCCCTTCAAACCATTCTACATAAA
>probe:Drosophila_2:1631163_at:71:671; Interrogation_Position=890; Antisense; TACTGGTTGGACATGACGACCCTCT
>probe:Drosophila_2:1631163_at:327:135; Interrogation_Position=905; Antisense; ACGACCCTCTTTGTTGGTTGTTGAT
>probe:Drosophila_2:1631163_at:558:467; Interrogation_Position=924; Antisense; GTTGATTGTCTGTTACCCAGCGCAA
>probe:Drosophila_2:1631163_at:61:359; Interrogation_Position=945; Antisense; GCAACAGACTTTTTCTTCTTTCCAC

Paste this into a BLAST search page for me
TTAAAACTCTCCATCGTTGGACCCAAGACGAAGACGGTGGCTACCTCAACGGCTACCTCAACCTACAAACGAATGAAATCGGATAACTCAGCCACCATATAAAATTCGCTACTGGGTGTTCTTATGGGTGTTCTTATACCAAATCCAGACCTAGGATTTATTCCCAAGGCTCCACGTGCCCTGTCAATGCTTCGTAAAAGTCCTGTGAGGCCTAACGATGTCGATTGCCCTTCAAACCATTCTACATAAATACTGGTTGGACATGACGACCCTCTACGACCCTCTTTGTTGGTTGTTGATGTTGATTGTCTGTTACCCAGCGCAAGCAACAGACTTTTTCTTCTTTCCAC

Full Affymetrix probeset data:

Annotations for 1631163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720