Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631164_a_at:

>probe:Drosophila_2:1631164_a_at:377:705; Interrogation_Position=596; Antisense; TTAGCTTTATTATCTACGCCCTCAT
>probe:Drosophila_2:1631164_a_at:676:317; Interrogation_Position=637; Antisense; GCCGTATGCATTTTGGTGTGGTCCA
>probe:Drosophila_2:1631164_a_at:607:19; Interrogation_Position=672; Antisense; ATTTGCTCCGCATCTCGAGAACGAG
>probe:Drosophila_2:1631164_a_at:577:709; Interrogation_Position=757; Antisense; TTCAAGGTACCTGCATCACTGGCTT
>probe:Drosophila_2:1631164_a_at:511:645; Interrogation_Position=772; Antisense; TCACTGGCTTTGCTGGTTAATCTAG
>probe:Drosophila_2:1631164_a_at:290:481; Interrogation_Position=796; Antisense; GTATTCCTCATACGCATCATGTGGG
>probe:Drosophila_2:1631164_a_at:393:665; Interrogation_Position=831; Antisense; TAAATTACGTTCTGCTCATACCCTG
>probe:Drosophila_2:1631164_a_at:293:647; Interrogation_Position=846; Antisense; TCATACCCTGGAAACGCGGCAGTAT
>probe:Drosophila_2:1631164_a_at:370:371; Interrogation_Position=882; Antisense; GAAGGCGCTGCTGGTGCTGATACCT
>probe:Drosophila_2:1631164_a_at:18:585; Interrogation_Position=912; Antisense; TGGCATCACCTATCTGTTGGTGCTA
>probe:Drosophila_2:1631164_a_at:704:465; Interrogation_Position=927; Antisense; GTTGGTGCTAACAGGCCCGGAACAG
>probe:Drosophila_2:1631164_a_at:514:299; Interrogation_Position=942; Antisense; CCCGGAACAGGGTATCAGTCGTAAT
>probe:Drosophila_2:1631164_a_at:291:87; Interrogation_Position=958; Antisense; AGTCGTAATCTCTTCGAGGCCATAA
>probe:Drosophila_2:1631164_a_at:390:213; Interrogation_Position=981; Antisense; AAGAGCCTTTCTCATAAGCACGCAG

Paste this into a BLAST search page for me
TTAGCTTTATTATCTACGCCCTCATGCCGTATGCATTTTGGTGTGGTCCAATTTGCTCCGCATCTCGAGAACGAGTTCAAGGTACCTGCATCACTGGCTTTCACTGGCTTTGCTGGTTAATCTAGGTATTCCTCATACGCATCATGTGGGTAAATTACGTTCTGCTCATACCCTGTCATACCCTGGAAACGCGGCAGTATGAAGGCGCTGCTGGTGCTGATACCTTGGCATCACCTATCTGTTGGTGCTAGTTGGTGCTAACAGGCCCGGAACAGCCCGGAACAGGGTATCAGTCGTAATAGTCGTAATCTCTTCGAGGCCATAAAAGAGCCTTTCTCATAAGCACGCAG

Full Affymetrix probeset data:

Annotations for 1631164_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime