FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631165_at:

>probe:Drosophila_2:1631165_at:251:407; Interrogation_Position=429; Antisense; GACTGTCCGCCAGGGATTCGCCAAT
>probe:Drosophila_2:1631165_at:538:463; Interrogation_Position=443; Antisense; GATTCGCCAATGTCGATGTGGCACA
>probe:Drosophila_2:1631165_at:333:521; Interrogation_Position=460; Antisense; GTGGCACATCATGAACGCAAGCTGA
>probe:Drosophila_2:1631165_at:634:359; Interrogation_Position=476; Antisense; GCAAGCTGACCGAGGCGTATATTAT
>probe:Drosophila_2:1631165_at:711:687; Interrogation_Position=495; Antisense; TATTATCATGGAGCGTTACCTGGAA
>probe:Drosophila_2:1631165_at:512:239; Interrogation_Position=520; Antisense; AATAGCGATTTTATGGCCGGGCCAC
>probe:Drosophila_2:1631165_at:334:403; Interrogation_Position=559; Antisense; GACTTATCCATCGTGACCACATTGA
>probe:Drosophila_2:1631165_at:43:727; Interrogation_Position=580; Antisense; TTGAGCACCGTCAATCTCATGTTTC
>probe:Drosophila_2:1631165_at:9:591; Interrogation_Position=634; Antisense; TGGTTCACCGCGATGCAGCAGCTGG
>probe:Drosophila_2:1631165_at:10:121; Interrogation_Position=653; Antisense; AGCTGGATGCCTACGAGGCCAACTG
>probe:Drosophila_2:1631165_at:716:83; Interrogation_Position=679; Antisense; AGTGGCTTGGAGAAGCTCCGCCAAA
>probe:Drosophila_2:1631165_at:232:425; Interrogation_Position=709; Antisense; GAGAGCGTCGGTAGCTTTCAGTTCC
>probe:Drosophila_2:1631165_at:32:95; Interrogation_Position=728; Antisense; AGTTCCCATCGTCATCAGCGGTAGT
>probe:Drosophila_2:1631165_at:346:239; Interrogation_Position=965; Antisense; AATAAACCGATTCATGGCAGACAAT

Paste this into a BLAST search page for me
GACTGTCCGCCAGGGATTCGCCAATGATTCGCCAATGTCGATGTGGCACAGTGGCACATCATGAACGCAAGCTGAGCAAGCTGACCGAGGCGTATATTATTATTATCATGGAGCGTTACCTGGAAAATAGCGATTTTATGGCCGGGCCACGACTTATCCATCGTGACCACATTGATTGAGCACCGTCAATCTCATGTTTCTGGTTCACCGCGATGCAGCAGCTGGAGCTGGATGCCTACGAGGCCAACTGAGTGGCTTGGAGAAGCTCCGCCAAAGAGAGCGTCGGTAGCTTTCAGTTCCAGTTCCCATCGTCATCAGCGGTAGTAATAAACCGATTCATGGCAGACAAT

Full Affymetrix probeset data:

Annotations for 1631165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720