FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631166_at:

>probe:Drosophila_2:1631166_at:601:617; Interrogation_Position=1116; Antisense; TGCAGCAACTGCACTTGAAGCCACA
>probe:Drosophila_2:1631166_at:657:311; Interrogation_Position=1135; Antisense; GCCACATCATGTTCAGCAACTGCAA
>probe:Drosophila_2:1631166_at:13:167; Interrogation_Position=1222; Antisense; AAATCCATAGATTTGTAATCCCCTA
>probe:Drosophila_2:1631166_at:172:601; Interrogation_Position=1235; Antisense; TGTAATCCCCTAATCATAGCAAGAA
>probe:Drosophila_2:1631166_at:41:83; Interrogation_Position=723; Antisense; AGGGCATCCAGCAGTGCCACGGACC
>probe:Drosophila_2:1631166_at:87:145; Interrogation_Position=783; Antisense; ACTGCAGCGATGAGTGTGGCTCTAA
>probe:Drosophila_2:1631166_at:550:433; Interrogation_Position=794; Antisense; GAGTGTGGCTCTAATCTAGCCATCG
>probe:Drosophila_2:1631166_at:110:655; Interrogation_Position=805; Antisense; TAATCTAGCCATCGAACGCCTATTT
>probe:Drosophila_2:1631166_at:438:381; Interrogation_Position=818; Antisense; GAACGCCTATTTCAGATTCTGCCGC
>probe:Drosophila_2:1631166_at:264:95; Interrogation_Position=831; Antisense; AGATTCTGCCGCAACAAATGCAAGA
>probe:Drosophila_2:1631166_at:570:99; Interrogation_Position=853; Antisense; AGAGTGGAATATTACGCCTAGCCGC
>probe:Drosophila_2:1631166_at:514:187; Interrogation_Position=889; Antisense; AACACGCAAGCATCTAGAGCTCAAC
>probe:Drosophila_2:1631166_at:557:113; Interrogation_Position=897; Antisense; AGCATCTAGAGCTCAACATGGACGA
>probe:Drosophila_2:1631166_at:104:567; Interrogation_Position=969; Antisense; GGCAACAGATACAGACTCAGCAGAA

Paste this into a BLAST search page for me
TGCAGCAACTGCACTTGAAGCCACAGCCACATCATGTTCAGCAACTGCAAAAATCCATAGATTTGTAATCCCCTATGTAATCCCCTAATCATAGCAAGAAAGGGCATCCAGCAGTGCCACGGACCACTGCAGCGATGAGTGTGGCTCTAAGAGTGTGGCTCTAATCTAGCCATCGTAATCTAGCCATCGAACGCCTATTTGAACGCCTATTTCAGATTCTGCCGCAGATTCTGCCGCAACAAATGCAAGAAGAGTGGAATATTACGCCTAGCCGCAACACGCAAGCATCTAGAGCTCAACAGCATCTAGAGCTCAACATGGACGAGGCAACAGATACAGACTCAGCAGAA

Full Affymetrix probeset data:

Annotations for 1631166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720