FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631167_at:

>probe:Drosophila_2:1631167_at:380:331; Interrogation_Position=261; Antisense; GCGGCACCAACTTCCAACTGATGGA
>probe:Drosophila_2:1631167_at:74:121; Interrogation_Position=294; Antisense; AGCGTTTCCAGGCAGCGGTCAAGAA
>probe:Drosophila_2:1631167_at:633:119; Interrogation_Position=307; Antisense; AGCGGTCAAGAAGTACGGTGTGCCC
>probe:Drosophila_2:1631167_at:504:75; Interrogation_Position=333; Antisense; AGGAGGAGATCTTCCAAACCGCCGA
>probe:Drosophila_2:1631167_at:617:175; Interrogation_Position=348; Antisense; AAACCGCCGATCTTTTCGAGCGTCG
>probe:Drosophila_2:1631167_at:418:319; Interrogation_Position=404; Antisense; GCCCTTGGACGCATCACGCAAAAGC
>probe:Drosophila_2:1631167_at:685:227; Interrogation_Position=450; Antisense; CACTGGGACCCAAGATGGCCGACAA
>probe:Drosophila_2:1631167_at:198:505; Interrogation_Position=507; Antisense; GTGCCCACGAGGGTGAGCTCAACCT
>probe:Drosophila_2:1631167_at:28:119; Interrogation_Position=522; Antisense; AGCTCAACCTGCAGATGGGCTTCAA
>probe:Drosophila_2:1631167_at:503:63; Interrogation_Position=536; Antisense; ATGGGCTTCAACAAGGGCGCCTCGC
>probe:Drosophila_2:1631167_at:553:287; Interrogation_Position=564; Antisense; CTGGACACGGTGGTATGGGCAACAC
>probe:Drosophila_2:1631167_at:412:221; Interrogation_Position=690; Antisense; AAGTGGGTTTTGTATCTCGTGCGTC
>probe:Drosophila_2:1631167_at:307:281; Interrogation_Position=705; Antisense; CTCGTGCGTCATGGCGCATGATTTA
>probe:Drosophila_2:1631167_at:670:349; Interrogation_Position=731; Antisense; GCAGTGCCAAGCTCTAAATGTAATT

Paste this into a BLAST search page for me
GCGGCACCAACTTCCAACTGATGGAAGCGTTTCCAGGCAGCGGTCAAGAAAGCGGTCAAGAAGTACGGTGTGCCCAGGAGGAGATCTTCCAAACCGCCGAAAACCGCCGATCTTTTCGAGCGTCGGCCCTTGGACGCATCACGCAAAAGCCACTGGGACCCAAGATGGCCGACAAGTGCCCACGAGGGTGAGCTCAACCTAGCTCAACCTGCAGATGGGCTTCAAATGGGCTTCAACAAGGGCGCCTCGCCTGGACACGGTGGTATGGGCAACACAAGTGGGTTTTGTATCTCGTGCGTCCTCGTGCGTCATGGCGCATGATTTAGCAGTGCCAAGCTCTAAATGTAATT

Full Affymetrix probeset data:

Annotations for 1631167_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720