FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631168_at:

>probe:Drosophila_2:1631168_at:609:527; Interrogation_Position=2174; Antisense; GGGATTCACATCTTGGCCCATTTTC
>probe:Drosophila_2:1631168_at:36:719; Interrogation_Position=2196; Antisense; TTCCGGCTGAGCTACATGTGGTACA
>probe:Drosophila_2:1631168_at:444:333; Interrogation_Position=2254; Antisense; GCTGGTTCATTTCGCTGATCATTGA
>probe:Drosophila_2:1631168_at:291:37; Interrogation_Position=2271; Antisense; ATCATTGACTTTATCCAGCGACGCA
>probe:Drosophila_2:1631168_at:468:303; Interrogation_Position=2332; Antisense; CCGCCGTGTCGGAGGAGATCTTCAA
>probe:Drosophila_2:1631168_at:467:213; Interrogation_Position=2355; Antisense; AAGAGCGACTCCCAGGTGCAGTACA
>probe:Drosophila_2:1631168_at:584:729; Interrogation_Position=2395; Antisense; TTGGCGATCCGCGAGAGCTCACAAG
>probe:Drosophila_2:1631168_at:30:119; Interrogation_Position=2410; Antisense; AGCTCACAAGTGACGAGGGCCATGT
>probe:Drosophila_2:1631168_at:288:511; Interrogation_Position=2433; Antisense; GTGAACCATGCCATTCGCATTGACG
>probe:Drosophila_2:1631168_at:522:9; Interrogation_Position=2519; Antisense; ATTCCTTGTGTAACCTCCATGTAAC
>probe:Drosophila_2:1631168_at:329:129; Interrogation_Position=2542; Antisense; ACCTCCATGTACAAAGACCAGTCGC
>probe:Drosophila_2:1631168_at:67:503; Interrogation_Position=2562; Antisense; GTCGCAATCTGTTAACTGTCCTAGT
>probe:Drosophila_2:1631168_at:616:457; Interrogation_Position=2601; Antisense; GATTTCTAGTTCTTAAGTCCCAGCC
>probe:Drosophila_2:1631168_at:430:571; Interrogation_Position=2635; Antisense; GGCTCAGTATTCTGTACACACACTT

Paste this into a BLAST search page for me
GGGATTCACATCTTGGCCCATTTTCTTCCGGCTGAGCTACATGTGGTACAGCTGGTTCATTTCGCTGATCATTGAATCATTGACTTTATCCAGCGACGCACCGCCGTGTCGGAGGAGATCTTCAAAAGAGCGACTCCCAGGTGCAGTACATTGGCGATCCGCGAGAGCTCACAAGAGCTCACAAGTGACGAGGGCCATGTGTGAACCATGCCATTCGCATTGACGATTCCTTGTGTAACCTCCATGTAACACCTCCATGTACAAAGACCAGTCGCGTCGCAATCTGTTAACTGTCCTAGTGATTTCTAGTTCTTAAGTCCCAGCCGGCTCAGTATTCTGTACACACACTT

Full Affymetrix probeset data:

Annotations for 1631168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720