FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631169_at:

>probe:Drosophila_2:1631169_at:692:717; Interrogation_Position=112; Antisense; TTCCAGTACTTCGAAAGGCCCAAGT
>probe:Drosophila_2:1631169_at:183:217; Interrogation_Position=133; Antisense; AAGTACCGTTATCCCTACTACGATG
>probe:Drosophila_2:1631169_at:97:669; Interrogation_Position=148; Antisense; TACTACGATGAACACGGGCGCGGAA
>probe:Drosophila_2:1631169_at:80:341; Interrogation_Position=16; Antisense; GCTAAATTGAGTGCCCTGCTGCTGC
>probe:Drosophila_2:1631169_at:225:521; Interrogation_Position=163; Antisense; GGGCGCGGAAAACTTCTCTACGGCT
>probe:Drosophila_2:1631169_at:426:389; Interrogation_Position=170; Antisense; GAAAACTTCTCTACGGCTACGGCGG
>probe:Drosophila_2:1631169_at:402:665; Interrogation_Position=187; Antisense; TACGGCGGACCGGAATTGTACCAAT
>probe:Drosophila_2:1631169_at:625:239; Interrogation_Position=209; Antisense; AATACAAGACCTACACGCCCTTGGA
>probe:Drosophila_2:1631169_at:125:157; Interrogation_Position=221; Antisense; ACACGCCCTTGGAGGGCATTCACTA
>probe:Drosophila_2:1631169_at:546:283; Interrogation_Position=34; Antisense; CTGCTGCCCCTAATTTTGTTTATTG
>probe:Drosophila_2:1631169_at:338:699; Interrogation_Position=52; Antisense; TTTATTGTGGCCTTTGTGGCGCACA
>probe:Drosophila_2:1631169_at:618:521; Interrogation_Position=67; Antisense; GTGGCGCACACAACTTTTGCTACAG
>probe:Drosophila_2:1631169_at:685:159; Interrogation_Position=76; Antisense; ACAACTTTTGCTACAGTGCAGCCAA
>probe:Drosophila_2:1631169_at:560:255; Interrogation_Position=98; Antisense; CAAAAGCACCGAACTTCCAGTACTT

Paste this into a BLAST search page for me
TTCCAGTACTTCGAAAGGCCCAAGTAAGTACCGTTATCCCTACTACGATGTACTACGATGAACACGGGCGCGGAAGCTAAATTGAGTGCCCTGCTGCTGCGGGCGCGGAAAACTTCTCTACGGCTGAAAACTTCTCTACGGCTACGGCGGTACGGCGGACCGGAATTGTACCAATAATACAAGACCTACACGCCCTTGGAACACGCCCTTGGAGGGCATTCACTACTGCTGCCCCTAATTTTGTTTATTGTTTATTGTGGCCTTTGTGGCGCACAGTGGCGCACACAACTTTTGCTACAGACAACTTTTGCTACAGTGCAGCCAACAAAAGCACCGAACTTCCAGTACTT

Full Affymetrix probeset data:

Annotations for 1631169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720