FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631172_at:

>probe:Drosophila_2:1631172_at:489:21; Interrogation_Position=1547; Antisense; ATATTTGCACTATCAAGACCCCTCG
>probe:Drosophila_2:1631172_at:285:103; Interrogation_Position=1562; Antisense; AGACCCCTCGAGCAAACAGAATGTT
>probe:Drosophila_2:1631172_at:591:329; Interrogation_Position=1589; Antisense; GCGGAGGATGCTTTTTCCTACACAA
>probe:Drosophila_2:1631172_at:691:169; Interrogation_Position=1613; Antisense; AAAGGTCATTGCATCTTCATCTCGG
>probe:Drosophila_2:1631172_at:222:525; Interrogation_Position=1685; Antisense; GGGCATTGCACCAGTAGCTATTTGG
>probe:Drosophila_2:1631172_at:32:59; Interrogation_Position=1761; Antisense; ATGAGGCATTCTGTGTGGCCGCCGA
>probe:Drosophila_2:1631172_at:126:465; Interrogation_Position=1873; Antisense; GATTGCCGAGGCCATATTCTCGTAC
>probe:Drosophila_2:1631172_at:623:11; Interrogation_Position=1888; Antisense; ATTCTCGTACGCCTTTGGACGCGGA
>probe:Drosophila_2:1631172_at:406:587; Interrogation_Position=1903; Antisense; TGGACGCGGATTGGCCACTCTATAT
>probe:Drosophila_2:1631172_at:82:151; Interrogation_Position=1992; Antisense; ACATCGTTGACGTTTACTGCATGCA
>probe:Drosophila_2:1631172_at:181:185; Interrogation_Position=2016; Antisense; AAAATCGTAGTATCGCCACCACGGA
>probe:Drosophila_2:1631172_at:641:563; Interrogation_Position=2038; Antisense; GGAATCCCGCAAGTACTACACGCTT
>probe:Drosophila_2:1631172_at:510:257; Interrogation_Position=2056; Antisense; CACGCTTGATATCTAGGACCTGTAC
>probe:Drosophila_2:1631172_at:152:541; Interrogation_Position=2071; Antisense; GGACCTGTACTTACGTTTAGGCCAT

Paste this into a BLAST search page for me
ATATTTGCACTATCAAGACCCCTCGAGACCCCTCGAGCAAACAGAATGTTGCGGAGGATGCTTTTTCCTACACAAAAAGGTCATTGCATCTTCATCTCGGGGGCATTGCACCAGTAGCTATTTGGATGAGGCATTCTGTGTGGCCGCCGAGATTGCCGAGGCCATATTCTCGTACATTCTCGTACGCCTTTGGACGCGGATGGACGCGGATTGGCCACTCTATATACATCGTTGACGTTTACTGCATGCAAAAATCGTAGTATCGCCACCACGGAGGAATCCCGCAAGTACTACACGCTTCACGCTTGATATCTAGGACCTGTACGGACCTGTACTTACGTTTAGGCCAT

Full Affymetrix probeset data:

Annotations for 1631172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720