FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631173_at:

>probe:Drosophila_2:1631173_at:693:579; Interrogation_Position=1296; Antisense; GGCCACCAGAGGAGCACAATCACTA
>probe:Drosophila_2:1631173_at:5:241; Interrogation_Position=1313; Antisense; AATCACTATGGCAGCTCACTCATGG
>probe:Drosophila_2:1631173_at:330:581; Interrogation_Position=1383; Antisense; TGGCCAGGCACATGGTCCAAGTGAT
>probe:Drosophila_2:1631173_at:185:693; Interrogation_Position=1454; Antisense; TTTGATCTCGCTCTGATGCAGGCAC
>probe:Drosophila_2:1631173_at:149:49; Interrogation_Position=1516; Antisense; ATCCACGCCACTGGGTGATAGCGAT
>probe:Drosophila_2:1631173_at:89:219; Interrogation_Position=1548; Antisense; AAGTCAAGGCCCAATGTGTGTGCGA
>probe:Drosophila_2:1631173_at:710:229; Interrogation_Position=1560; Antisense; AATGTGTGTGCGAGGCCAGCCAAAT
>probe:Drosophila_2:1631173_at:88:47; Interrogation_Position=1630; Antisense; ATCCGGTGTTCATTAGGCGCCATTA
>probe:Drosophila_2:1631173_at:214:15; Interrogation_Position=1651; Antisense; ATTAGCTTTATCAGCGATCGTCCCA
>probe:Drosophila_2:1631173_at:673:633; Interrogation_Position=1671; Antisense; TCCCATCGATCGGTTTCCAATTGAT
>probe:Drosophila_2:1631173_at:6:249; Interrogation_Position=1689; Antisense; AATTGATTTTTATGCCTGTTCGCGC
>probe:Drosophila_2:1631173_at:249:317; Interrogation_Position=1702; Antisense; GCCTGTTCGCGCAATTACTTTTATT
>probe:Drosophila_2:1631173_at:84:327; Interrogation_Position=1752; Antisense; GCGTTTTGTTTATCTCAAACCTCGT
>probe:Drosophila_2:1631173_at:88:701; Interrogation_Position=1794; Antisense; TTTTTATGTACTGACTGCTGTGAAC

Paste this into a BLAST search page for me
GGCCACCAGAGGAGCACAATCACTAAATCACTATGGCAGCTCACTCATGGTGGCCAGGCACATGGTCCAAGTGATTTTGATCTCGCTCTGATGCAGGCACATCCACGCCACTGGGTGATAGCGATAAGTCAAGGCCCAATGTGTGTGCGAAATGTGTGTGCGAGGCCAGCCAAATATCCGGTGTTCATTAGGCGCCATTAATTAGCTTTATCAGCGATCGTCCCATCCCATCGATCGGTTTCCAATTGATAATTGATTTTTATGCCTGTTCGCGCGCCTGTTCGCGCAATTACTTTTATTGCGTTTTGTTTATCTCAAACCTCGTTTTTTATGTACTGACTGCTGTGAAC

Full Affymetrix probeset data:

Annotations for 1631173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720