FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631174_at:

>probe:Drosophila_2:1631174_at:655:723; Interrogation_Position=243; Antisense; TTGGCAAGCTGCAGGGCGGTCTCAA
>probe:Drosophila_2:1631174_at:290:75; Interrogation_Position=273; Antisense; AGGAGTACTTCATTTCGTTGACCCA
>probe:Drosophila_2:1631174_at:572:609; Interrogation_Position=291; Antisense; TGACCCAAACCCTCGTGGGCAAGAT
>probe:Drosophila_2:1631174_at:388:623; Interrogation_Position=345; Antisense; TGCCCAACTGGGACGAGTTCCAGAA
>probe:Drosophila_2:1631174_at:38:595; Interrogation_Position=390; Antisense; TGGGCAGCACCTCTTCCATGAACAA
>probe:Drosophila_2:1631174_at:320:253; Interrogation_Position=418; Antisense; CAAGAACGTACTCGAGGAGGCCTTT
>probe:Drosophila_2:1631174_at:389:547; Interrogation_Position=433; Antisense; GGAGGCCTTTTTCCTGAACAAGACT
>probe:Drosophila_2:1631174_at:474:375; Interrogation_Position=494; Antisense; GAAGAGCTCAAATCTCGCCATACTG
>probe:Drosophila_2:1631174_at:676:27; Interrogation_Position=513; Antisense; ATACTGCCACAGAACTGGAACTCGA
>probe:Drosophila_2:1631174_at:24:383; Interrogation_Position=530; Antisense; GAACTCGAATCAGATCCCCAGAACA
>probe:Drosophila_2:1631174_at:377:167; Interrogation_Position=579; Antisense; AAATGCCATACACCGATTTCTTCAG
>probe:Drosophila_2:1631174_at:516:645; Interrogation_Position=597; Antisense; TCTTCAGGCGCATCATCATCATAAT
>probe:Drosophila_2:1631174_at:382:191; Interrogation_Position=627; Antisense; AACTTATCCACATGACACGGCTCAA
>probe:Drosophila_2:1631174_at:246:165; Interrogation_Position=710; Antisense; AAATCCATTGGGTCATCCCAGTTGA

Paste this into a BLAST search page for me
TTGGCAAGCTGCAGGGCGGTCTCAAAGGAGTACTTCATTTCGTTGACCCATGACCCAAACCCTCGTGGGCAAGATTGCCCAACTGGGACGAGTTCCAGAATGGGCAGCACCTCTTCCATGAACAACAAGAACGTACTCGAGGAGGCCTTTGGAGGCCTTTTTCCTGAACAAGACTGAAGAGCTCAAATCTCGCCATACTGATACTGCCACAGAACTGGAACTCGAGAACTCGAATCAGATCCCCAGAACAAAATGCCATACACCGATTTCTTCAGTCTTCAGGCGCATCATCATCATAATAACTTATCCACATGACACGGCTCAAAAATCCATTGGGTCATCCCAGTTGA

Full Affymetrix probeset data:

Annotations for 1631174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720