FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631177_at:

>probe:Drosophila_2:1631177_at:514:19; Interrogation_Position=4325; Antisense; ATATTCCATTGGGTCGCAGCGAAAC
>probe:Drosophila_2:1631177_at:722:189; Interrogation_Position=4381; Antisense; AACATGCGTTCCGATGTGATCCTCG
>probe:Drosophila_2:1631177_at:1:143; Interrogation_Position=4418; Antisense; ACGGCAGTGTGCGACTGTTTGACAA
>probe:Drosophila_2:1631177_at:148:481; Interrogation_Position=4434; Antisense; GTTTGACAAGCGTTGTGCGCCGCAG
>probe:Drosophila_2:1631177_at:55:291; Interrogation_Position=4464; Antisense; CGGGATCTCCGTTTATCGACGACAC
>probe:Drosophila_2:1631177_at:609:177; Interrogation_Position=4521; Antisense; AAACGGACTGGTGCTGGTCTCCGGC
>probe:Drosophila_2:1631177_at:600:13; Interrogation_Position=4597; Antisense; ATTAACCCCTTCGATGTTGTGTACG
>probe:Drosophila_2:1631177_at:618:31; Interrogation_Position=4651; Antisense; ATAACCAGCCACCAGTTGGAGGACA
>probe:Drosophila_2:1631177_at:672:565; Interrogation_Position=4687; Antisense; GGCAATGCCTCCAAGATCGTGATCT
>probe:Drosophila_2:1631177_at:253:605; Interrogation_Position=4706; Antisense; TGATCTACTCGCTGGACGGACGGCA
>probe:Drosophila_2:1631177_at:715:619; Interrogation_Position=4739; Antisense; TGCTGCGGACGAACGAGGGTTTCAT
>probe:Drosophila_2:1631177_at:214:529; Interrogation_Position=4755; Antisense; GGGTTTCATTGGTCCCAAGATCGGT
>probe:Drosophila_2:1631177_at:625:309; Interrogation_Position=4784; Antisense; CCACGTATCTGTATTTTCACCCATA
>probe:Drosophila_2:1631177_at:503:719; Interrogation_Position=4820; Antisense; TTGCGGTGGGCTTCGTGGACAATAC

Paste this into a BLAST search page for me
ATATTCCATTGGGTCGCAGCGAAACAACATGCGTTCCGATGTGATCCTCGACGGCAGTGTGCGACTGTTTGACAAGTTTGACAAGCGTTGTGCGCCGCAGCGGGATCTCCGTTTATCGACGACACAAACGGACTGGTGCTGGTCTCCGGCATTAACCCCTTCGATGTTGTGTACGATAACCAGCCACCAGTTGGAGGACAGGCAATGCCTCCAAGATCGTGATCTTGATCTACTCGCTGGACGGACGGCATGCTGCGGACGAACGAGGGTTTCATGGGTTTCATTGGTCCCAAGATCGGTCCACGTATCTGTATTTTCACCCATATTGCGGTGGGCTTCGTGGACAATAC

Full Affymetrix probeset data:

Annotations for 1631177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720