FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631180_at:

>probe:Drosophila_2:1631180_at:319:5; Interrogation_Position=4038; Antisense; ATTGCGGGCCTTGCCAAATCAAGAG
>probe:Drosophila_2:1631180_at:282:165; Interrogation_Position=4053; Antisense; AAATCAAGAGCACATCCCCTGCATT
>probe:Drosophila_2:1631180_at:147:3; Interrogation_Position=4075; Antisense; ATTGTGTCCTTTGCCAAGTTGTATG
>probe:Drosophila_2:1631180_at:676:443; Interrogation_Position=4138; Antisense; GATGATGTAGTCACTTCCTATCCCA
>probe:Drosophila_2:1631180_at:206:713; Interrogation_Position=4152; Antisense; TTCCTATCCCAAACGAATCGACATC
>probe:Drosophila_2:1631180_at:75:151; Interrogation_Position=4193; Antisense; ACATGCTAATCAAGGCGGGTCTAAT
>probe:Drosophila_2:1631180_at:580:285; Interrogation_Position=4208; Antisense; CGGGTCTAATCGATTCCGCGAGAAA
>probe:Drosophila_2:1631180_at:437:723; Interrogation_Position=4237; Antisense; TTGGAGCGTGCCGTGGTGCAAAAAC
>probe:Drosophila_2:1631180_at:291:33; Interrogation_Position=4316; Antisense; ATCACGGCACGGATGCAACGGTGGC
>probe:Drosophila_2:1631180_at:216:533; Interrogation_Position=4368; Antisense; GGTGAAGAACTACGCCAAGACGGTC
>probe:Drosophila_2:1631180_at:14:539; Interrogation_Position=4389; Antisense; GGTCAAGTAGTTTCATCATGCCCCA
>probe:Drosophila_2:1631180_at:505:269; Interrogation_Position=4405; Antisense; CATGCCCCACCTTTTTAGTTTGTAG
>probe:Drosophila_2:1631180_at:535:589; Interrogation_Position=4503; Antisense; TGTGATTCCGAGTGCTACCTTTAAA
>probe:Drosophila_2:1631180_at:163:31; Interrogation_Position=4568; Antisense; ATAAAACGTTGCTTTGGCCATGCCC

Paste this into a BLAST search page for me
ATTGCGGGCCTTGCCAAATCAAGAGAAATCAAGAGCACATCCCCTGCATTATTGTGTCCTTTGCCAAGTTGTATGGATGATGTAGTCACTTCCTATCCCATTCCTATCCCAAACGAATCGACATCACATGCTAATCAAGGCGGGTCTAATCGGGTCTAATCGATTCCGCGAGAAATTGGAGCGTGCCGTGGTGCAAAAACATCACGGCACGGATGCAACGGTGGCGGTGAAGAACTACGCCAAGACGGTCGGTCAAGTAGTTTCATCATGCCCCACATGCCCCACCTTTTTAGTTTGTAGTGTGATTCCGAGTGCTACCTTTAAAATAAAACGTTGCTTTGGCCATGCCC

Full Affymetrix probeset data:

Annotations for 1631180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720