Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631182_at:

>probe:Drosophila_2:1631182_at:185:453; Interrogation_Position=1024; Antisense; GATCAAGACGTTCCAGCTGACTATG
>probe:Drosophila_2:1631182_at:686:173; Interrogation_Position=459; Antisense; AAACGATGCCGATTGGTTCCTAGAG
>probe:Drosophila_2:1631182_at:134:715; Interrogation_Position=475; Antisense; TTCCTAGAGGCTGACGACGAGACGT
>probe:Drosophila_2:1631182_at:606:355; Interrogation_Position=595; Antisense; GCACTGCGTCGCTTGGTTGAGCTAT
>probe:Drosophila_2:1631182_at:674:331; Interrogation_Position=705; Antisense; GCTGGCGGGCAATACTTACGATTCT
>probe:Drosophila_2:1631182_at:148:527; Interrogation_Position=732; Antisense; GGGACGTAGGCGCATGTATCTCATC
>probe:Drosophila_2:1631182_at:232:483; Interrogation_Position=747; Antisense; GTATCTCATCGAACCGCAGGCCAGA
>probe:Drosophila_2:1631182_at:487:39; Interrogation_Position=776; Antisense; ATCTGTTTCTGCACTATGATTCGAA
>probe:Drosophila_2:1631182_at:653:33; Interrogation_Position=802; Antisense; ATCTGGTTTTGGAAGTTCCTCGCCT
>probe:Drosophila_2:1631182_at:23:721; Interrogation_Position=817; Antisense; TTCCTCGCCTACAGAACGCAAGATG
>probe:Drosophila_2:1631182_at:2:345; Interrogation_Position=850; Antisense; GCTTGGTCCAACTATGCGGTATCGT
>probe:Drosophila_2:1631182_at:590:295; Interrogation_Position=865; Antisense; GCGGTATCGTTTCACTACGTTCAAC
>probe:Drosophila_2:1631182_at:197:669; Interrogation_Position=880; Antisense; TACGTTCAACATCGCTATATCCACT
>probe:Drosophila_2:1631182_at:513:95; Interrogation_Position=950; Antisense; AGATTGTAGAATCGCTTCCACCTAA

Paste this into a BLAST search page for me
GATCAAGACGTTCCAGCTGACTATGAAACGATGCCGATTGGTTCCTAGAGTTCCTAGAGGCTGACGACGAGACGTGCACTGCGTCGCTTGGTTGAGCTATGCTGGCGGGCAATACTTACGATTCTGGGACGTAGGCGCATGTATCTCATCGTATCTCATCGAACCGCAGGCCAGAATCTGTTTCTGCACTATGATTCGAAATCTGGTTTTGGAAGTTCCTCGCCTTTCCTCGCCTACAGAACGCAAGATGGCTTGGTCCAACTATGCGGTATCGTGCGGTATCGTTTCACTACGTTCAACTACGTTCAACATCGCTATATCCACTAGATTGTAGAATCGCTTCCACCTAA

Full Affymetrix probeset data:

Annotations for 1631182_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime