FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631183_at:

>probe:Drosophila_2:1631183_at:299:143; Interrogation_Position=450; Antisense; ACTGCCGGCCAGGAGGATTACGAAA
>probe:Drosophila_2:1631183_at:441:609; Interrogation_Position=487; Antisense; TGAGCTATCCCAGTACCAACTGCTT
>probe:Drosophila_2:1631183_at:295:195; Interrogation_Position=504; Antisense; AACTGCTTCCTGTTGTGCTATTCGA
>probe:Drosophila_2:1631183_at:405:715; Interrogation_Position=524; Antisense; TTCGATCAGCAGTAGGACCTCATTC
>probe:Drosophila_2:1631183_at:593:567; Interrogation_Position=618; Antisense; GGCACCAAACTGGACTTGCGCATTC
>probe:Drosophila_2:1631183_at:139:721; Interrogation_Position=633; Antisense; TTGCGCATTCCCAACTCGGAGAAGT
>probe:Drosophila_2:1631183_at:473:125; Interrogation_Position=646; Antisense; ACTCGGAGAAGTTCGTGACCACACA
>probe:Drosophila_2:1631183_at:7:457; Interrogation_Position=695; Antisense; GATACACGCATTCAACTTGGTCGAG
>probe:Drosophila_2:1631183_at:375:591; Interrogation_Position=712; Antisense; TGGTCGAGTGCTCCGCCAAGAAGAA
>probe:Drosophila_2:1631183_at:623:409; Interrogation_Position=794; Antisense; GACGACGTCCAAGCAATCGTGCAAA
>probe:Drosophila_2:1631183_at:310:509; Interrogation_Position=824; Antisense; GTGAACTATGTGTATGCCTAATTTT
>probe:Drosophila_2:1631183_at:407:705; Interrogation_Position=874; Antisense; TTATGCTACTAATTCGCCTGACTAT
>probe:Drosophila_2:1631183_at:344:315; Interrogation_Position=889; Antisense; GCCTGACTATTTGTGCTTCGTTTTC
>probe:Drosophila_2:1631183_at:355:657; Interrogation_Position=964; Antisense; TAAGTGCCACTTGTGTGAATCCTTA

Paste this into a BLAST search page for me
ACTGCCGGCCAGGAGGATTACGAAATGAGCTATCCCAGTACCAACTGCTTAACTGCTTCCTGTTGTGCTATTCGATTCGATCAGCAGTAGGACCTCATTCGGCACCAAACTGGACTTGCGCATTCTTGCGCATTCCCAACTCGGAGAAGTACTCGGAGAAGTTCGTGACCACACAGATACACGCATTCAACTTGGTCGAGTGGTCGAGTGCTCCGCCAAGAAGAAGACGACGTCCAAGCAATCGTGCAAAGTGAACTATGTGTATGCCTAATTTTTTATGCTACTAATTCGCCTGACTATGCCTGACTATTTGTGCTTCGTTTTCTAAGTGCCACTTGTGTGAATCCTTA

Full Affymetrix probeset data:

Annotations for 1631183_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720