Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631190_at:

>probe:Drosophila_2:1631190_at:291:201; Interrogation_Position=1292; Antisense; AACCCACTCCAGTCTGCAAAATCTG
>probe:Drosophila_2:1631190_at:448:387; Interrogation_Position=1374; Antisense; GAACAAGAGGAATTTCACCTGCGAA
>probe:Drosophila_2:1631190_at:503:129; Interrogation_Position=1390; Antisense; ACCTGCGAAATCTGCGGAGCGAATT
>probe:Drosophila_2:1631190_at:66:245; Interrogation_Position=1411; Antisense; AATTTCTACAGTCAGGGCACCATGC
>probe:Drosophila_2:1631190_at:414:201; Interrogation_Position=1437; Antisense; AACCCACCGAAAAGCAGTGCATCTT
>probe:Drosophila_2:1631190_at:644:617; Interrogation_Position=1454; Antisense; TGCATCTTTTAGTTCACACCGTTCA
>probe:Drosophila_2:1631190_at:326:511; Interrogation_Position=1481; Antisense; GTGAAGTTTGCGATCTGACCATTAA
>probe:Drosophila_2:1631190_at:297:373; Interrogation_Position=1509; Antisense; GAAGGGAAATTACCGCAGGCACTGC
>probe:Drosophila_2:1631190_at:586:355; Interrogation_Position=1527; Antisense; GCACTGCAAATCTCAAAGCCATAAG
>probe:Drosophila_2:1631190_at:560:183; Interrogation_Position=1590; Antisense; AAAAGATAGCAATCGCCGCAAAGGG
>probe:Drosophila_2:1631190_at:265:377; Interrogation_Position=1645; Antisense; GAAGCAAGTTCGTCAACAAACACAT
>probe:Drosophila_2:1631190_at:460:209; Interrogation_Position=1726; Antisense; AAGCAGACCCACTTGAAAACACCCT
>probe:Drosophila_2:1631190_at:727:611; Interrogation_Position=1739; Antisense; TGAAAACACCCTGCAGGTCGAAAAA
>probe:Drosophila_2:1631190_at:153:663; Interrogation_Position=1776; Antisense; TAAAATCTGTGAAACCTGCGGAAAT

Paste this into a BLAST search page for me
AACCCACTCCAGTCTGCAAAATCTGGAACAAGAGGAATTTCACCTGCGAAACCTGCGAAATCTGCGGAGCGAATTAATTTCTACAGTCAGGGCACCATGCAACCCACCGAAAAGCAGTGCATCTTTGCATCTTTTAGTTCACACCGTTCAGTGAAGTTTGCGATCTGACCATTAAGAAGGGAAATTACCGCAGGCACTGCGCACTGCAAATCTCAAAGCCATAAGAAAAGATAGCAATCGCCGCAAAGGGGAAGCAAGTTCGTCAACAAACACATAAGCAGACCCACTTGAAAACACCCTTGAAAACACCCTGCAGGTCGAAAAATAAAATCTGTGAAACCTGCGGAAAT

Full Affymetrix probeset data:

Annotations for 1631190_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime