FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631191_at:

>probe:Drosophila_2:1631191_at:26:327; Interrogation_Position=1944; Antisense; GCGACTGTCGTTGCGAAACTACCAT
>probe:Drosophila_2:1631191_at:69:391; Interrogation_Position=1958; Antisense; GAAACTACCATCTCATCACAAATCA
>probe:Drosophila_2:1631191_at:495:163; Interrogation_Position=1977; Antisense; AAATCATACCCTGGAGCACCTGGTG
>probe:Drosophila_2:1631191_at:102:87; Interrogation_Position=2003; Antisense; AGTGCTCTCCGAATCTGGTGTATAT
>probe:Drosophila_2:1631191_at:461:601; Interrogation_Position=2031; Antisense; TGTTAGTGGCACCAGCATTACGCTT
>probe:Drosophila_2:1631191_at:42:247; Interrogation_Position=2061; Antisense; AATTCGGCGCTTCAAGATCTCCAAA
>probe:Drosophila_2:1631191_at:519:171; Interrogation_Position=2126; Antisense; AAAGACTTCCGGAGCTGGAGACACA
>probe:Drosophila_2:1631191_at:330:517; Interrogation_Position=2239; Antisense; GTGGTGGCTCCTTAGAATATTGTTT
>probe:Drosophila_2:1631191_at:441:95; Interrogation_Position=2268; Antisense; AGATTCCGTCGAAGTGGGCCGTGCT
>probe:Drosophila_2:1631191_at:532:441; Interrogation_Position=2339; Antisense; GATGGATCCACAACGCTGGCTACAA
>probe:Drosophila_2:1631191_at:652:205; Interrogation_Position=2362; Antisense; AAGCGAGTGCTGTAGCTCAGCCATC
>probe:Drosophila_2:1631191_at:333:339; Interrogation_Position=2376; Antisense; GCTCAGCCATCTAGTATTACGTTTG
>probe:Drosophila_2:1631191_at:557:665; Interrogation_Position=2424; Antisense; TACACGCCAGGCTAAACGCACTGTA
>probe:Drosophila_2:1631191_at:62:417; Interrogation_Position=2493; Antisense; GAGCGCGCGAGATCCTTTTGGTAAA

Paste this into a BLAST search page for me
GCGACTGTCGTTGCGAAACTACCATGAAACTACCATCTCATCACAAATCAAAATCATACCCTGGAGCACCTGGTGAGTGCTCTCCGAATCTGGTGTATATTGTTAGTGGCACCAGCATTACGCTTAATTCGGCGCTTCAAGATCTCCAAAAAAGACTTCCGGAGCTGGAGACACAGTGGTGGCTCCTTAGAATATTGTTTAGATTCCGTCGAAGTGGGCCGTGCTGATGGATCCACAACGCTGGCTACAAAAGCGAGTGCTGTAGCTCAGCCATCGCTCAGCCATCTAGTATTACGTTTGTACACGCCAGGCTAAACGCACTGTAGAGCGCGCGAGATCCTTTTGGTAAA

Full Affymetrix probeset data:

Annotations for 1631191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720