FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631192_at:

>probe:Drosophila_2:1631192_at:161:203; Interrogation_Position=1468; Antisense; AACCATTTGTATGTTCGCCTGGGCA
>probe:Drosophila_2:1631192_at:541:309; Interrogation_Position=1500; Antisense; CCAGCCTCAGGGTTTGATCCAGAAT
>probe:Drosophila_2:1631192_at:116:33; Interrogation_Position=1523; Antisense; ATAAGTTGACTGTGCGTCCCATGCT
>probe:Drosophila_2:1631192_at:359:51; Interrogation_Position=1543; Antisense; ATGCTGGACTCCAATTTCGGACAGA
>probe:Drosophila_2:1631192_at:472:101; Interrogation_Position=1565; Antisense; AGAGTCATGTCCAGGCCTTGCGTAA
>probe:Drosophila_2:1631192_at:366:635; Interrogation_Position=1590; Antisense; TCGAGCCACGAATAAGCCACAGTCT
>probe:Drosophila_2:1631192_at:538:533; Interrogation_Position=1626; Antisense; GGTGATAACGAACATGGGCTCCAAT
>probe:Drosophila_2:1631192_at:332:547; Interrogation_Position=1680; Antisense; GGAGGAATTGTCCAAGCTTCGCCAG
>probe:Drosophila_2:1631192_at:219:209; Interrogation_Position=1693; Antisense; AAGCTTCGCCAGGAGGGTCGTGAAA
>probe:Drosophila_2:1631192_at:53:377; Interrogation_Position=1734; Antisense; GAAGAATCATCCTCCGAAACGTGAC
>probe:Drosophila_2:1631192_at:473:511; Interrogation_Position=1754; Antisense; GTGACAGGCACTATCAAGGCTCCGA
>probe:Drosophila_2:1631192_at:346:227; Interrogation_Position=1769; Antisense; AAGGCTCCGATCACAATGTGGCCAA
>probe:Drosophila_2:1631192_at:86:445; Interrogation_Position=1912; Antisense; GATGATGCTTCTTGGAGCTCACCCA
>probe:Drosophila_2:1631192_at:149:135; Interrogation_Position=2008; Antisense; ACGCGTTTGGTCTATTCCGGATCAG

Paste this into a BLAST search page for me
AACCATTTGTATGTTCGCCTGGGCACCAGCCTCAGGGTTTGATCCAGAATATAAGTTGACTGTGCGTCCCATGCTATGCTGGACTCCAATTTCGGACAGAAGAGTCATGTCCAGGCCTTGCGTAATCGAGCCACGAATAAGCCACAGTCTGGTGATAACGAACATGGGCTCCAATGGAGGAATTGTCCAAGCTTCGCCAGAAGCTTCGCCAGGAGGGTCGTGAAAGAAGAATCATCCTCCGAAACGTGACGTGACAGGCACTATCAAGGCTCCGAAAGGCTCCGATCACAATGTGGCCAAGATGATGCTTCTTGGAGCTCACCCAACGCGTTTGGTCTATTCCGGATCAG

Full Affymetrix probeset data:

Annotations for 1631192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720