Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631193_at:

>probe:Drosophila_2:1631193_at:392:137; Interrogation_Position=1073; Antisense; ACGAGCCACCATCTTACGACAGTTG
>probe:Drosophila_2:1631193_at:2:713; Interrogation_Position=1111; Antisense; TTCAGTTTTGCTACCCTGGCAGGAA
>probe:Drosophila_2:1631193_at:220:635; Interrogation_Position=1186; Antisense; TTGCCCAAGTTTCCTGGATTTTCCA
>probe:Drosophila_2:1631193_at:250:701; Interrogation_Position=1204; Antisense; TTTTCCACACTCATTGGGACAGCTC
>probe:Drosophila_2:1631193_at:295:559; Interrogation_Position=1220; Antisense; GGACAGCTCCTGCTCACGGAATGGA
>probe:Drosophila_2:1631193_at:537:437; Interrogation_Position=1243; Antisense; GAGGACTCTGGCCTGGACATGCACA
>probe:Drosophila_2:1631193_at:121:491; Interrogation_Position=1269; Antisense; GTACAGGTCGTACGGATCGCTTAAC
>probe:Drosophila_2:1631193_at:610:157; Interrogation_Position=1292; Antisense; ACACGGATCACACAGGTCGGAGTCT
>probe:Drosophila_2:1631193_at:153:501; Interrogation_Position=1307; Antisense; GTCGGAGTCTGGACACTTTCGGATC
>probe:Drosophila_2:1631193_at:635:517; Interrogation_Position=1337; Antisense; GTGGTCCACTGTCCGAACATGTCGA
>probe:Drosophila_2:1631193_at:48:215; Interrogation_Position=1382; Antisense; AAGAGAACCTGGATGTGACTGCCCA
>probe:Drosophila_2:1631193_at:570:509; Interrogation_Position=1408; Antisense; GTGCATCGGCCGATTCAACGGGCAA
>probe:Drosophila_2:1631193_at:613:691; Interrogation_Position=900; Antisense; TTTGCAACACCTCAGGGACTCGGTT
>probe:Drosophila_2:1631193_at:539:105; Interrogation_Position=964; Antisense; AGACAGCGCCTGATCGAGCGGGTAA

Paste this into a BLAST search page for me
ACGAGCCACCATCTTACGACAGTTGTTCAGTTTTGCTACCCTGGCAGGAATTGCCCAAGTTTCCTGGATTTTCCATTTTCCACACTCATTGGGACAGCTCGGACAGCTCCTGCTCACGGAATGGAGAGGACTCTGGCCTGGACATGCACAGTACAGGTCGTACGGATCGCTTAACACACGGATCACACAGGTCGGAGTCTGTCGGAGTCTGGACACTTTCGGATCGTGGTCCACTGTCCGAACATGTCGAAAGAGAACCTGGATGTGACTGCCCAGTGCATCGGCCGATTCAACGGGCAATTTGCAACACCTCAGGGACTCGGTTAGACAGCGCCTGATCGAGCGGGTAA

Full Affymetrix probeset data:

Annotations for 1631193_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime