FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631194_at:

>probe:Drosophila_2:1631194_at:168:489; Interrogation_Position=1000; Antisense; GTACCCAATTGAATGCCACGACTGA
>probe:Drosophila_2:1631194_at:723:307; Interrogation_Position=1015; Antisense; CCACGACTGAGCTAAATCCAACCAA
>probe:Drosophila_2:1631194_at:533:213; Interrogation_Position=1045; Antisense; AAGAGACCTTGGACATCATGAGAAA
>probe:Drosophila_2:1631194_at:693:33; Interrogation_Position=1109; Antisense; ATCGTAGTTGTATTCGCCGTAGTGT
>probe:Drosophila_2:1631194_at:520:441; Interrogation_Position=1137; Antisense; GATGGTGCCATTAAATGTGCCTCTG
>probe:Drosophila_2:1631194_at:663:107; Interrogation_Position=1242; Antisense; AGCAAGCGAGTCTCTTTATTATCAA
>probe:Drosophila_2:1631194_at:136:703; Interrogation_Position=1299; Antisense; TTTTGCTCAAGCAGTGTGACCTTTT
>probe:Drosophila_2:1631194_at:465:507; Interrogation_Position=1314; Antisense; GTGACCTTTTGATGCGACAACGTTA
>probe:Drosophila_2:1631194_at:57:343; Interrogation_Position=836; Antisense; GCTTATTATACCAGTCTCTTCAAGG
>probe:Drosophila_2:1631194_at:305:613; Interrogation_Position=866; Antisense; TGAAGTACCAGAACCTCCCAAGACG
>probe:Drosophila_2:1631194_at:449:421; Interrogation_Position=894; Antisense; GAGAAACCAGTTCCTACCATAACAA
>probe:Drosophila_2:1631194_at:690:661; Interrogation_Position=913; Antisense; TAACAAGCAAATCAACTCCTCCATT
>probe:Drosophila_2:1631194_at:419:631; Interrogation_Position=929; Antisense; TCCTCCATTGGATGGCACCCAGAAA
>probe:Drosophila_2:1631194_at:498:159; Interrogation_Position=961; Antisense; ACAAACTCAGAGCATGCGGTGTGGA

Paste this into a BLAST search page for me
GTACCCAATTGAATGCCACGACTGACCACGACTGAGCTAAATCCAACCAAAAGAGACCTTGGACATCATGAGAAAATCGTAGTTGTATTCGCCGTAGTGTGATGGTGCCATTAAATGTGCCTCTGAGCAAGCGAGTCTCTTTATTATCAATTTTGCTCAAGCAGTGTGACCTTTTGTGACCTTTTGATGCGACAACGTTAGCTTATTATACCAGTCTCTTCAAGGTGAAGTACCAGAACCTCCCAAGACGGAGAAACCAGTTCCTACCATAACAATAACAAGCAAATCAACTCCTCCATTTCCTCCATTGGATGGCACCCAGAAAACAAACTCAGAGCATGCGGTGTGGA

Full Affymetrix probeset data:

Annotations for 1631194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720