FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631195_at:

>probe:Drosophila_2:1631195_at:355:477; Interrogation_Position=1015; Antisense; GTTTTACGCTAACCAGAACCCACAG
>probe:Drosophila_2:1631195_at:608:647; Interrogation_Position=1051; Antisense; TCAGTCGGACGAACCACATTGCCTA
>probe:Drosophila_2:1631195_at:169:271; Interrogation_Position=1067; Antisense; CATTGCCTACTACATGAATCCGACG
>probe:Drosophila_2:1631195_at:577:615; Interrogation_Position=1081; Antisense; TGAATCCGACGACTCTGTCCAAGTA
>probe:Drosophila_2:1631195_at:9:73; Interrogation_Position=1147; Antisense; AGGTTTACATCTCGGACCTCAAACA
>probe:Drosophila_2:1631195_at:253:31; Interrogation_Position=1201; Antisense; ATAATCTGTTTCTCAGGGCGAGGCA
>probe:Drosophila_2:1631195_at:679:93; Interrogation_Position=1243; Antisense; AGTTGCTCCAGCATGTCAGCCAGAT
>probe:Drosophila_2:1631195_at:297:71; Interrogation_Position=1285; Antisense; AGGCGTTGCTCCAGCTGGGAAAGTC
>probe:Drosophila_2:1631195_at:548:393; Interrogation_Position=1303; Antisense; GAAAGTCTGGTCACAGTCGACTGTT
>probe:Drosophila_2:1631195_at:310:505; Interrogation_Position=1356; Antisense; GTGCCAGTCTGATACTCTGTACTTT
>probe:Drosophila_2:1631195_at:480:63; Interrogation_Position=847; Antisense; ATGGGAACGATCTGGGAGCCGCTTT
>probe:Drosophila_2:1631195_at:644:553; Interrogation_Position=861; Antisense; GGAGCCGCTTTCAGAAGGCCTTATC
>probe:Drosophila_2:1631195_at:210:439; Interrogation_Position=911; Antisense; GAGGCAGTCACTCTACCAAACACAG
>probe:Drosophila_2:1631195_at:258:69; Interrogation_Position=998; Antisense; AGGCGCTCCTGCTTACAGTTTTACG

Paste this into a BLAST search page for me
GTTTTACGCTAACCAGAACCCACAGTCAGTCGGACGAACCACATTGCCTACATTGCCTACTACATGAATCCGACGTGAATCCGACGACTCTGTCCAAGTAAGGTTTACATCTCGGACCTCAAACAATAATCTGTTTCTCAGGGCGAGGCAAGTTGCTCCAGCATGTCAGCCAGATAGGCGTTGCTCCAGCTGGGAAAGTCGAAAGTCTGGTCACAGTCGACTGTTGTGCCAGTCTGATACTCTGTACTTTATGGGAACGATCTGGGAGCCGCTTTGGAGCCGCTTTCAGAAGGCCTTATCGAGGCAGTCACTCTACCAAACACAGAGGCGCTCCTGCTTACAGTTTTACG

Full Affymetrix probeset data:

Annotations for 1631195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720