FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631196_at:

>probe:Drosophila_2:1631196_at:644:61; Interrogation_Position=186; Antisense; ATGTCTGCACCGCTAGAGAACCTTG
>probe:Drosophila_2:1631196_at:333:423; Interrogation_Position=201; Antisense; GAGAACCTTGAGACCCAGCTAGAGA
>probe:Drosophila_2:1631196_at:485:421; Interrogation_Position=234; Antisense; GAGAATGTTCGTCAGATCCGCATAA
>probe:Drosophila_2:1631196_at:385:659; Interrogation_Position=262; Antisense; TAAGCGATTTTCAGCCACAGGGTCA
>probe:Drosophila_2:1631196_at:226:387; Interrogation_Position=302; Antisense; GAAAATCTTGGTGACCGGCCTACAA
>probe:Drosophila_2:1631196_at:160:81; Interrogation_Position=349; Antisense; AGGTGCAGGACGTCTATGTGCCATT
>probe:Drosophila_2:1631196_at:248:515; Interrogation_Position=378; Antisense; GTGTTTTTTGACTACATCGACCAAG
>probe:Drosophila_2:1631196_at:559:251; Interrogation_Position=404; Antisense; CAAGAATCCTCAGCTGTACACCAAG
>probe:Drosophila_2:1631196_at:21:367; Interrogation_Position=503; Antisense; GAATCTGCTGCTGGAGCTGTATAAA
>probe:Drosophila_2:1631196_at:76:609; Interrogation_Position=539; Antisense; TGAGATGAACAACTACCGCGCTTAT
>probe:Drosophila_2:1631196_at:527:323; Interrogation_Position=556; Antisense; GCGCTTATCGCAAGGACTCCATGTA
>probe:Drosophila_2:1631196_at:221:405; Interrogation_Position=570; Antisense; GACTCCATGTAAGGACGTGCTCGAA
>probe:Drosophila_2:1631196_at:406:557; Interrogation_Position=595; Antisense; GGACACGCGACCTGAACTTTAGATT
>probe:Drosophila_2:1631196_at:345:305; Interrogation_Position=64; Antisense; CCTGGTCATTCGGTGTTTTCTAGAA

Paste this into a BLAST search page for me
ATGTCTGCACCGCTAGAGAACCTTGGAGAACCTTGAGACCCAGCTAGAGAGAGAATGTTCGTCAGATCCGCATAATAAGCGATTTTCAGCCACAGGGTCAGAAAATCTTGGTGACCGGCCTACAAAGGTGCAGGACGTCTATGTGCCATTGTGTTTTTTGACTACATCGACCAAGCAAGAATCCTCAGCTGTACACCAAGGAATCTGCTGCTGGAGCTGTATAAATGAGATGAACAACTACCGCGCTTATGCGCTTATCGCAAGGACTCCATGTAGACTCCATGTAAGGACGTGCTCGAAGGACACGCGACCTGAACTTTAGATTCCTGGTCATTCGGTGTTTTCTAGAA

Full Affymetrix probeset data:

Annotations for 1631196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720