Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631197_at:

>probe:Drosophila_2:1631197_at:272:197; Interrogation_Position=237; Antisense; AACGGCGTTATTCTGATAGCGGGTC
>probe:Drosophila_2:1631197_at:241:1; Interrogation_Position=252; Antisense; ATAGCGGGTCTTCACTTTTTGTTCG
>probe:Drosophila_2:1631197_at:441:615; Interrogation_Position=280; Antisense; TGAAGGCCTACGACCTGCGATGCAT
>probe:Drosophila_2:1631197_at:8:179; Interrogation_Position=309; Antisense; AAACTGCCGCTGGATCACGAGCTGA
>probe:Drosophila_2:1631197_at:59:99; Interrogation_Position=345; Antisense; AGATGGTTGACCTACTCGTACTTCT
>probe:Drosophila_2:1631197_at:437:131; Interrogation_Position=457; Antisense; ACCTGGTGATGTCCTTTGGCGGATA
>probe:Drosophila_2:1631197_at:693:721; Interrogation_Position=472; Antisense; TTGGCGGATACCTGCACATTACCTT
>probe:Drosophila_2:1631197_at:718:709; Interrogation_Position=495; Antisense; TTCAACGGCTATGGAGGCACTCTGT
>probe:Drosophila_2:1631197_at:594:15; Interrogation_Position=524; Antisense; ATTATGCCTGCTCAATGTGGCGGTC
>probe:Drosophila_2:1631197_at:696:711; Interrogation_Position=648; Antisense; TTCATCCTGGTGCTGGCGAACTTTA
>probe:Drosophila_2:1631197_at:260:575; Interrogation_Position=662; Antisense; GGCGAACTTTAGCTACACCCTGATG
>probe:Drosophila_2:1631197_at:97:235; Interrogation_Position=699; Antisense; AATGCCTCCCGAACTGTGATATATA
>probe:Drosophila_2:1631197_at:412:29; Interrogation_Position=721; Antisense; ATACTGGCATGTTCATTTCCACGAC
>probe:Drosophila_2:1631197_at:514:713; Interrogation_Position=747; Antisense; TTCATCCTGATGTTTGCCAACTTCT

Paste this into a BLAST search page for me
AACGGCGTTATTCTGATAGCGGGTCATAGCGGGTCTTCACTTTTTGTTCGTGAAGGCCTACGACCTGCGATGCATAAACTGCCGCTGGATCACGAGCTGAAGATGGTTGACCTACTCGTACTTCTACCTGGTGATGTCCTTTGGCGGATATTGGCGGATACCTGCACATTACCTTTTCAACGGCTATGGAGGCACTCTGTATTATGCCTGCTCAATGTGGCGGTCTTCATCCTGGTGCTGGCGAACTTTAGGCGAACTTTAGCTACACCCTGATGAATGCCTCCCGAACTGTGATATATAATACTGGCATGTTCATTTCCACGACTTCATCCTGATGTTTGCCAACTTCT

Full Affymetrix probeset data:

Annotations for 1631197_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime