FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631198_at:

>probe:Drosophila_2:1631198_at:34:659; Interrogation_Position=1955; Antisense; TAAGCGACCCGAGTACGGAGGCGAT
>probe:Drosophila_2:1631198_at:202:69; Interrogation_Position=1978; Antisense; ATGGCGAGGATGGACCACCGGTCAA
>probe:Drosophila_2:1631198_at:496:261; Interrogation_Position=1993; Antisense; CACCGGTCAAGGATCTCGAGGCAAA
>probe:Drosophila_2:1631198_at:635:109; Interrogation_Position=2098; Antisense; AGAAGGTGTCCCTTGTGCGCGCCAA
>probe:Drosophila_2:1631198_at:316:207; Interrogation_Position=2130; Antisense; AAGCTGCGCAAACGTCCGGGCAAAC
>probe:Drosophila_2:1631198_at:138:681; Interrogation_Position=2155; Antisense; TAGGAGCCGCCACCGAAGTTCACAG
>probe:Drosophila_2:1631198_at:448:373; Interrogation_Position=2169; Antisense; GAAGTTCACAGAAGCGGTGCCTCCG
>probe:Drosophila_2:1631198_at:235:331; Interrogation_Position=2212; Antisense; GCGGCGGTCAGTCGGCATTTACTAA
>probe:Drosophila_2:1631198_at:367:569; Interrogation_Position=2225; Antisense; GGCATTTACTAACGACTTGACCGAT
>probe:Drosophila_2:1631198_at:681:217; Interrogation_Position=2252; Antisense; AAGTCGTGGCGGAGCTCTGCGTCTA
>probe:Drosophila_2:1631198_at:335:641; Interrogation_Position=2267; Antisense; TCTGCGTCTAAGGTCCGAGGCCAAT
>probe:Drosophila_2:1631198_at:220:85; Interrogation_Position=2302; Antisense; AGATGACCAAGATCGCTGCTAAGAA
>probe:Drosophila_2:1631198_at:211:357; Interrogation_Position=2383; Antisense; GCAAGAACTTCGGAGGACCTCGTCA
>probe:Drosophila_2:1631198_at:629:71; Interrogation_Position=2396; Antisense; AGGACCTCGTCACGCCAAGAAGGAT

Paste this into a BLAST search page for me
TAAGCGACCCGAGTACGGAGGCGATATGGCGAGGATGGACCACCGGTCAACACCGGTCAAGGATCTCGAGGCAAAAGAAGGTGTCCCTTGTGCGCGCCAAAAGCTGCGCAAACGTCCGGGCAAACTAGGAGCCGCCACCGAAGTTCACAGGAAGTTCACAGAAGCGGTGCCTCCGGCGGCGGTCAGTCGGCATTTACTAAGGCATTTACTAACGACTTGACCGATAAGTCGTGGCGGAGCTCTGCGTCTATCTGCGTCTAAGGTCCGAGGCCAATAGATGACCAAGATCGCTGCTAAGAAGCAAGAACTTCGGAGGACCTCGTCAAGGACCTCGTCACGCCAAGAAGGAT

Full Affymetrix probeset data:

Annotations for 1631198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720