FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631199_at:

>probe:Drosophila_2:1631199_at:326:411; Interrogation_Position=2599; Antisense; GACGCGCAGCTCCAGTGATAGCTAC
>probe:Drosophila_2:1631199_at:660:83; Interrogation_Position=2612; Antisense; AGTGATAGCTACTCCTCCAGTTCGT
>probe:Drosophila_2:1631199_at:220:289; Interrogation_Position=2673; Antisense; CGGCGGCCAATATTATCGTAGATGA
>probe:Drosophila_2:1631199_at:711:399; Interrogation_Position=2701; Antisense; GACAGCTCTGCAGAATGCCGTCAAT
>probe:Drosophila_2:1631199_at:532:493; Interrogation_Position=2720; Antisense; GTCAATGTTTAGAGCCGGTCTCGGT
>probe:Drosophila_2:1631199_at:5:537; Interrogation_Position=2736; Antisense; GGTCTCGGTTGAATTTCGCGGAAAT
>probe:Drosophila_2:1631199_at:8:639; Interrogation_Position=2761; Antisense; TCGTTTTCTCGTTTTAGCTTTGCGT
>probe:Drosophila_2:1631199_at:385:601; Interrogation_Position=2796; Antisense; TATTCGGAGTTCACCTAGATTTAGT
>probe:Drosophila_2:1631199_at:354:91; Interrogation_Position=2818; Antisense; AGTTAAATCAATGCTGCTTCCCCGC
>probe:Drosophila_2:1631199_at:313:301; Interrogation_Position=2837; Antisense; CCCCGCTCGCAGGAACAAATATTTT
>probe:Drosophila_2:1631199_at:594:225; Interrogation_Position=2969; Antisense; AAGGCTACCAGGACGCAACACTTAA
>probe:Drosophila_2:1631199_at:643:157; Interrogation_Position=3051; Antisense; ACACGTCCCACATGCATGTGTGTGT
>probe:Drosophila_2:1631199_at:571:233; Interrogation_Position=3124; Antisense; AATCCAATAAACAACGGCGCCTAGG
>probe:Drosophila_2:1631199_at:6:681; Interrogation_Position=3145; Antisense; TAGGGCGCTACATTCCACAGTATAA

Paste this into a BLAST search page for me
GACGCGCAGCTCCAGTGATAGCTACAGTGATAGCTACTCCTCCAGTTCGTCGGCGGCCAATATTATCGTAGATGAGACAGCTCTGCAGAATGCCGTCAATGTCAATGTTTAGAGCCGGTCTCGGTGGTCTCGGTTGAATTTCGCGGAAATTCGTTTTCTCGTTTTAGCTTTGCGTTATTCGGAGTTCACCTAGATTTAGTAGTTAAATCAATGCTGCTTCCCCGCCCCCGCTCGCAGGAACAAATATTTTAAGGCTACCAGGACGCAACACTTAAACACGTCCCACATGCATGTGTGTGTAATCCAATAAACAACGGCGCCTAGGTAGGGCGCTACATTCCACAGTATAA

Full Affymetrix probeset data:

Annotations for 1631199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720