FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631200_at:

>probe:Drosophila_2:1631200_at:45:295; Interrogation_Position=279; Antisense; CGACCACGCTACATCTGCTGATAAT
>probe:Drosophila_2:1631200_at:18:25; Interrogation_Position=302; Antisense; ATAGTTTGGCTACCGATGGCGATGC
>probe:Drosophila_2:1631200_at:123:487; Interrogation_Position=353; Antisense; GTAGCGATGGCAAGAGCGACTCCAA
>probe:Drosophila_2:1631200_at:490:605; Interrogation_Position=396; Antisense; TGATGCCACGCCAGCGAATGGTCAT
>probe:Drosophila_2:1631200_at:258:157; Interrogation_Position=512; Antisense; ACAGCCATCACAGTAGCTACGAGAT
>probe:Drosophila_2:1631200_at:386:35; Interrogation_Position=535; Antisense; ATCAGCATCGACGACAGCTTTGGCG
>probe:Drosophila_2:1631200_at:270:489; Interrogation_Position=564; Antisense; GTACGTGCGGTCCATTTACGAGAGC
>probe:Drosophila_2:1631200_at:152:425; Interrogation_Position=583; Antisense; GAGAGCAGCGAGAGCCACGGACATT
>probe:Drosophila_2:1631200_at:543:49; Interrogation_Position=617; Antisense; ATGCCGGCTCCAATCAGCGGGACAA
>probe:Drosophila_2:1631200_at:564:159; Interrogation_Position=638; Antisense; ACAATGGAGCCCGTGAGAGCAGTCA
>probe:Drosophila_2:1631200_at:5:223; Interrogation_Position=683; Antisense; AAGTGGCCAGCGAAGCGCCTGCTCA
>probe:Drosophila_2:1631200_at:152:537; Interrogation_Position=715; Antisense; GGCAACGTGCCAGATGGACCCGAAA
>probe:Drosophila_2:1631200_at:421:185; Interrogation_Position=773; Antisense; AACACAACCGGGAGATCTGACCACA
>probe:Drosophila_2:1631200_at:39:611; Interrogation_Position=790; Antisense; TGACCACAGGTTCGCTCGAGGGACT

Paste this into a BLAST search page for me
CGACCACGCTACATCTGCTGATAATATAGTTTGGCTACCGATGGCGATGCGTAGCGATGGCAAGAGCGACTCCAATGATGCCACGCCAGCGAATGGTCATACAGCCATCACAGTAGCTACGAGATATCAGCATCGACGACAGCTTTGGCGGTACGTGCGGTCCATTTACGAGAGCGAGAGCAGCGAGAGCCACGGACATTATGCCGGCTCCAATCAGCGGGACAAACAATGGAGCCCGTGAGAGCAGTCAAAGTGGCCAGCGAAGCGCCTGCTCAGGCAACGTGCCAGATGGACCCGAAAAACACAACCGGGAGATCTGACCACATGACCACAGGTTCGCTCGAGGGACT

Full Affymetrix probeset data:

Annotations for 1631200_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720