FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631204_at:

>probe:Drosophila_2:1631204_at:359:409; Interrogation_Position=113; Antisense; GACGCTCCGGAGAGATTTCCCGTGA
>probe:Drosophila_2:1631204_at:711:15; Interrogation_Position=127; Antisense; ATTTCCCGTGACTTCTGGGATCCAA
>probe:Drosophila_2:1631204_at:692:527; Interrogation_Position=143; Antisense; GGGATCCAACCCACTACTGGCAGTG
>probe:Drosophila_2:1631204_at:523:391; Interrogation_Position=15; Antisense; GAAAGCAGCTTTAGTCCTTCTCTTC
>probe:Drosophila_2:1631204_at:632:85; Interrogation_Position=164; Antisense; AGTGCTCTAGCACCGGACAGGCCGA
>probe:Drosophila_2:1631204_at:502:319; Interrogation_Position=184; Antisense; GCCGAGCTAGTTGCCTGCGAGCAGA
>probe:Drosophila_2:1631204_at:383:317; Interrogation_Position=196; Antisense; GCCTGCGAGCAGAACACTGGATTCG
>probe:Drosophila_2:1631204_at:711:141; Interrogation_Position=211; Antisense; ACTGGATTCGATCCGAAAACTGGAA
>probe:Drosophila_2:1631204_at:711:181; Interrogation_Position=226; Antisense; AAAACTGGAAGCTGCGTCGATTGGA
>probe:Drosophila_2:1631204_at:169:417; Interrogation_Position=249; Antisense; GAGCGTTTGGCAGTGGTATCCTCCA
>probe:Drosophila_2:1631204_at:302:591; Interrogation_Position=262; Antisense; TGGTATCCTCCATGTTCCGAAGCAT
>probe:Drosophila_2:1631204_at:134:629; Interrogation_Position=270; Antisense; TCCATGTTCCGAAGCATCCACTTAA
>probe:Drosophila_2:1631204_at:12:413; Interrogation_Position=67; Antisense; GACCTTGACTGCAATCCCGATGGCA
>probe:Drosophila_2:1631204_at:473:301; Interrogation_Position=82; Antisense; CCCGATGGCAATGGTGAGCCCGATT

Paste this into a BLAST search page for me
GACGCTCCGGAGAGATTTCCCGTGAATTTCCCGTGACTTCTGGGATCCAAGGGATCCAACCCACTACTGGCAGTGGAAAGCAGCTTTAGTCCTTCTCTTCAGTGCTCTAGCACCGGACAGGCCGAGCCGAGCTAGTTGCCTGCGAGCAGAGCCTGCGAGCAGAACACTGGATTCGACTGGATTCGATCCGAAAACTGGAAAAAACTGGAAGCTGCGTCGATTGGAGAGCGTTTGGCAGTGGTATCCTCCATGGTATCCTCCATGTTCCGAAGCATTCCATGTTCCGAAGCATCCACTTAAGACCTTGACTGCAATCCCGATGGCACCCGATGGCAATGGTGAGCCCGATT

Full Affymetrix probeset data:

Annotations for 1631204_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720