Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631205_a_at:

>probe:Drosophila_2:1631205_a_at:584:155; Interrogation_Position=1039; Antisense; ACACAGTGCTCGGTTCAAATCTATA
>probe:Drosophila_2:1631205_a_at:217:537; Interrogation_Position=538; Antisense; GGTCTGGTCAAGTCCATTGGTGTTT
>probe:Drosophila_2:1631205_a_at:263:435; Interrogation_Position=598; Antisense; GAGGTGGCCACTATTCCACCAGTAA
>probe:Drosophila_2:1631205_a_at:370:465; Interrogation_Position=630; Antisense; GATTGAGTGCCATCCATATCTGACC
>probe:Drosophila_2:1631205_a_at:627:557; Interrogation_Position=687; Antisense; GGACATTACAATCACTGCCTACAGT
>probe:Drosophila_2:1631205_a_at:244:227; Interrogation_Position=742; Antisense; AAGGCTGGTGATCCGGTCATCCTAG
>probe:Drosophila_2:1631205_a_at:261:375; Interrogation_Position=804; Antisense; GAAGACCCCTGGACAGATCCTTATT
>probe:Drosophila_2:1631205_a_at:350:11; Interrogation_Position=826; Antisense; ATTCGATACCAGGTTCAGCGTGCCA
>probe:Drosophila_2:1631205_a_at:513:473; Interrogation_Position=838; Antisense; GTTCAGCGTGCCAACATTGTTATCC
>probe:Drosophila_2:1631205_a_at:689:601; Interrogation_Position=855; Antisense; TGTTATCCCCAAATCTGTGACCAAG
>probe:Drosophila_2:1631205_a_at:62:41; Interrogation_Position=867; Antisense; ATCTGTGACCAAGGACCGCATCGAG
>probe:Drosophila_2:1631205_a_at:12:433; Interrogation_Position=889; Antisense; GAGTCCAACTTCCAGGTCTTCGACT
>probe:Drosophila_2:1631205_a_at:483:715; Interrogation_Position=907; Antisense; TTCGACTTCGAACTGACACCTGAGG
>probe:Drosophila_2:1631205_a_at:71:393; Interrogation_Position=946; Antisense; GAAAGCTTCGAGTGCAACGGCCGCC

Paste this into a BLAST search page for me
ACACAGTGCTCGGTTCAAATCTATAGGTCTGGTCAAGTCCATTGGTGTTTGAGGTGGCCACTATTCCACCAGTAAGATTGAGTGCCATCCATATCTGACCGGACATTACAATCACTGCCTACAGTAAGGCTGGTGATCCGGTCATCCTAGGAAGACCCCTGGACAGATCCTTATTATTCGATACCAGGTTCAGCGTGCCAGTTCAGCGTGCCAACATTGTTATCCTGTTATCCCCAAATCTGTGACCAAGATCTGTGACCAAGGACCGCATCGAGGAGTCCAACTTCCAGGTCTTCGACTTTCGACTTCGAACTGACACCTGAGGGAAAGCTTCGAGTGCAACGGCCGCC

Full Affymetrix probeset data:

Annotations for 1631205_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime