Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631206_a_at:

>probe:Drosophila_2:1631206_a_at:13:427; Interrogation_Position=517; Antisense; GAGATCATCAAATGTCCCTGCAACT
>probe:Drosophila_2:1631206_a_at:614:619; Interrogation_Position=574; Antisense; TGCTTGAAGCGCTGGATCATGCACA
>probe:Drosophila_2:1631206_a_at:423:75; Interrogation_Position=647; Antisense; AGGAGCGGGCCAGTCTGAAGCAAAT
>probe:Drosophila_2:1631206_a_at:632:167; Interrogation_Position=668; Antisense; AAATGATCCGAACCTTCTGCTGCGG
>probe:Drosophila_2:1631206_a_at:499:467; Interrogation_Position=698; Antisense; GTTGCGGCCTGATTGTGAAGCATCT
>probe:Drosophila_2:1631206_a_at:677:377; Interrogation_Position=714; Antisense; GAAGCATCTGCTATTTAGCGCCTCG
>probe:Drosophila_2:1631206_a_at:406:675; Interrogation_Position=749; Antisense; TAGCCCATATCATCTTGCAGCAGGT
>probe:Drosophila_2:1631206_a_at:715:225; Interrogation_Position=800; Antisense; AAGGCAGCACCGATCAGTTAACCGT
>probe:Drosophila_2:1631206_a_at:217:627; Interrogation_Position=818; Antisense; TAACCGTCCAGGAGGTGTTTGTCGC
>probe:Drosophila_2:1631206_a_at:253:617; Interrogation_Position=867; Antisense; TGCACTTTTCTTCCACTTCTTTGAG
>probe:Drosophila_2:1631206_a_at:249:147; Interrogation_Position=881; Antisense; ACTTCTTTGAGTTTGTCACCACACG
>probe:Drosophila_2:1631206_a_at:461:157; Interrogation_Position=901; Antisense; ACACGATTTATGCTCATCCGGAACA
>probe:Drosophila_2:1631206_a_at:522:561; Interrogation_Position=920; Antisense; GGAACATTCTCAGCCACTGGTGGAT
>probe:Drosophila_2:1631206_a_at:418:519; Interrogation_Position=939; Antisense; GTGGATGTTTGGCAGCACCTCCGAT

Paste this into a BLAST search page for me
GAGATCATCAAATGTCCCTGCAACTTGCTTGAAGCGCTGGATCATGCACAAGGAGCGGGCCAGTCTGAAGCAAATAAATGATCCGAACCTTCTGCTGCGGGTTGCGGCCTGATTGTGAAGCATCTGAAGCATCTGCTATTTAGCGCCTCGTAGCCCATATCATCTTGCAGCAGGTAAGGCAGCACCGATCAGTTAACCGTTAACCGTCCAGGAGGTGTTTGTCGCTGCACTTTTCTTCCACTTCTTTGAGACTTCTTTGAGTTTGTCACCACACGACACGATTTATGCTCATCCGGAACAGGAACATTCTCAGCCACTGGTGGATGTGGATGTTTGGCAGCACCTCCGAT

Full Affymetrix probeset data:

Annotations for 1631206_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime