Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631207_at:

>probe:Drosophila_2:1631207_at:112:703; Interrogation_Position=1905; Antisense; TTATCATCCGTACGGTAAGCCATCG
>probe:Drosophila_2:1631207_at:688:45; Interrogation_Position=1910; Antisense; ATCCGTACGGTAAGCCATCGATGCT
>probe:Drosophila_2:1631207_at:276:487; Interrogation_Position=1914; Antisense; GTACGGTAAGCCATCGATGCTGCCG
>probe:Drosophila_2:1631207_at:429:537; Interrogation_Position=1918; Antisense; GGTAAGCCATCGATGCTGCCGCCCT
>probe:Drosophila_2:1631207_at:117:637; Interrogation_Position=1942; Antisense; TCGTTGGCGCCACCCGGAATGCCCG
>probe:Drosophila_2:1631207_at:672:563; Interrogation_Position=1957; Antisense; GGAATGCCCGGACTGCCGCCACATC
>probe:Drosophila_2:1631207_at:391:577; Interrogation_Position=1983; Antisense; GGCGCTGGCCCAATATTTTGCACCG
>probe:Drosophila_2:1631207_at:20:333; Interrogation_Position=1986; Antisense; GCTGGCCCAATATTTTGCACCGTAC
>probe:Drosophila_2:1631207_at:80:581; Interrogation_Position=1988; Antisense; TGGCCCAATATTTTGCACCGTACTC
>probe:Drosophila_2:1631207_at:495:307; Interrogation_Position=1992; Antisense; CCAATATTTTGCACCGTACTCGTTA
>probe:Drosophila_2:1631207_at:202:17; Interrogation_Position=1995; Antisense; ATATTTTGCACCGTACTCGTTATAC
>probe:Drosophila_2:1631207_at:612:489; Interrogation_Position=2007; Antisense; GTACTCGTTATACGGTCCCAGGATG
>probe:Drosophila_2:1631207_at:406:277; Interrogation_Position=2010; Antisense; CTCGTTATACGGTCCCAGGATGGGA
>probe:Drosophila_2:1631207_at:614:667; Interrogation_Position=2017; Antisense; TACGGTCCCAGGATGGGATCTTCGC

Paste this into a BLAST search page for me
TTATCATCCGTACGGTAAGCCATCGATCCGTACGGTAAGCCATCGATGCTGTACGGTAAGCCATCGATGCTGCCGGGTAAGCCATCGATGCTGCCGCCCTTCGTTGGCGCCACCCGGAATGCCCGGGAATGCCCGGACTGCCGCCACATCGGCGCTGGCCCAATATTTTGCACCGGCTGGCCCAATATTTTGCACCGTACTGGCCCAATATTTTGCACCGTACTCCCAATATTTTGCACCGTACTCGTTAATATTTTGCACCGTACTCGTTATACGTACTCGTTATACGGTCCCAGGATGCTCGTTATACGGTCCCAGGATGGGATACGGTCCCAGGATGGGATCTTCGC

Full Affymetrix probeset data:

Annotations for 1631207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime